Skip to main content

Ethyl acetate extract of Elephantopus mollis Kunth induces apoptosis in human gastric cancer cells



Gastric cancer is one of the most leading causes of cancer death worldwide. Therefore, treatment studies have been being conducted, one of which is screening of novel agents from medicinal herbs. Elephantopus mollis Kunth (EM) belonging to Asteraceae family is a perennial herb with several therapeutic properties including anticancer activity. However, the effect of this species on gastric cancer has not been reported yet. In this study, cytotoxicity of different EM crude extracts was investigated on AGS gastric cancer cell line. Besides, the effects of extract on nuclear morphology, caspase-3 activation, and gene expression were also explored.


The results showed that ethyl acetate extract exhibited a remarkably inhibitory ability (IC50 = 27.5 μg/ml) on the growth of AGS cells, while causing less toxicity to normal human fibroblasts. The extract also induced apoptotic deaths in AGS cells as evidenced by cell shrinkage, formation of apoptotic bodies, nuclear fragmentation, caspase-3 activation, and the upregulation of BAK and APAF-1 pro-apoptotic genes related to mitochondrial signaling pathway. Specifically, BAK and APAF-1 mRNA expression levels showed 2.57 and 2.71-fold increases respectively.


The current study not only proved the anti-gastric cancer activity of EM ethyl acetate extract but also proposed its molecular mechanism. The extract could be a potential candidate for further investigation.

Peer Review reports


Gastric cancer is the fifth most frequently diagnosed cancer and third leading cause of cancer death worldwide, with over 1 million newly diagnosed cases and 783,000 deaths each year [1]. Although there have been efforts in Helicobacter pylori infection treatment [2, 3] and earlier diagnosis [4], the mortality incidence remains high [1]. For gastric cancer, surgery is the main curative therapy, while chemotherapy or chemoradiation can be used in combination [5]. However, the relapse of tumor [6], drug resistance [7], metastasis of cancer cells [8], and side effects of chemotherapy [9, 10] present as challenges affecting treatment efficacy and shortening survival time of patients. For those reasons, studies on gastric cancer treatment are ongoing, among which is screening of novel anticancer agents from nature [11]. Medicinal herbs are popularly used in folk medicine with several therapeutic properties, so they are considered as potential sources for investigation.

Elephantopus mollis Kunth (EM) belonging to Asteraceae family is a perennial herb up to 40 cm tall. This species is native to Central and South America, but also appears in Africa, Eastern Asia, Australia and Pacific Islands. In traditional folk medicine, EM is used as a febrifuge, diuretic, and antidote for snakebite. The whole plant is utilized to treat diarrhea, while leaves are used for ulcers and eczema [12]. In scientific reports, EM has been proved antibacterial [13], anti-inflammatory [14], and anticancer activities. The crude extracts of EM could inhibit varied human cancer cell lines, including breast carcinoma [15, 16], lung carcinoma [15,16,17], liver carcinoma [15, 16], leukemia [17], and colorectal carcinoma [15]. Regarding molecular mechanism, ethyl acetate extract could induce apoptotic deaths in HepG2 liver carcinoma cells as indicated by DNA fragmentation and caspase-3 activation [16], while methanol extract caused loss of mitochondrial integrity and exerted the increase in reactive oxygen species (ROS) level in MCF-7 breast carcinoma cells [16]. The ethyl acetate extract could also trigger apoptosis in A549 lung carcinoma cells by upregulating pro-apoptotic genes (BAK and BID) and downregulating anti-apoptotic gene BCL-2 [17]. Some triterpenes, sesquiterpene lactones and phenolic acid compounds from this species exhibited substantial anticancer activity [18,19,20,21]. Specifically, EM23 compound, a sesquiterpene lactone, was toxic to chronic and acute leukemia cells (IC50 = 10.8 and 1.9 μM respectively) due to thioredoxin system inhibition leading to the increase in intracellular ROS level, the activation of ASK-1/MAPK pathway and apoptotic deaths [21]. In addition, recently, EM2, a monomeric sesquiterpene lactone called 2β-methoxy-2- deethoxyphantomolin, was proved to inhibit liver carcinoma cells (IC50 = 5.89 μM) by causing G2/M arrest, exerting endoplasmic reticulum stress, and activating JNK pathway [22]. Thus, it is obvious that although anticancer activity of EM has been studied since 1970s, its potential has not been fully exploited yet.

Although there are several studies on anticancer activity of EM, no data has been recorded on its capacity towards gastric cancer yet. Therefore, in our study, cytotoxicity of EM crude extracts was investigated on AGS human gastric adenocarcinoma cell line.


Plant materials

Elephantopus mollis Kunth (local name: “cúc chỉ thiên mềm”, English name: soft elephant’s foot) was harvested in Bidoup - Nui Ba Vietnam National Park, Lam Dong Province, Vietnam. The plant was identified by Laboratory of Plants, University of Science, Vietnam National University, Ho Chi Minh City, Vietnam (voucher specimen: PHH0004880).


Solvents including ethanol, ethyl acetate and petroleum ether were purchased from Xilong (China). DMSO (99.9% (v/v)) was supplied by Sigma-Aldrich (Germany). Cell culture media consisting of RPMI-1640 and high glucose DMEM were obtained from Himedia (India) and Sigma-Aldrich (Germany). Fetal bovine serum (FBS), trypsin and MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were supplied by Sigma-Aldrich (Germany). Doxorubicin was supplied by Ebewe Pharma (Austria). Paraformaldehyde and Triton-X100 were obtained from Scharlau (Spain) and Pancreac AppliChem (Spain-Germany-Italia). Anti-cleaved caspase-3 antibodies (#9661), secondary antibodies (#A-11008), and normal goat serum (NGS) were purchased from Cell Signaling Technology (USA), Invitrogen (USA), and Vector Laboratories (Japan) respectively. TriSure Kit for RNA extraction, Tetro cDNA Synthesis Kit, and SensiFAST™ HRM Realtime PCR Kit were obtained from Bioline (UK). qPCR primers were supplied by PhuSa (Vietnam).

Plant extract preparation

Dried whole-plant materials were ground into powder. Next, the plant powder was immersed in 70% ethanol (ratio 1:10 (w/v)). Then, the whole solution was collected, filtered and concentrated by a rotary evaporator (Hahnvapor, Korea). After that, part of the solution was dried by a freeze drier (Benchtop K Virtis, USA) to obtain ethanol-extract powder. The remaining solution was sequentially extracted with petroleum ether and ethyl acetate solvents (ratio 1:1 (v/v)), then also concentrated by the rotary evaporator and dried by the freeze drier to gain powders of petroleum ether, ethyl acetate and water extracts. The efficiency of total extraction was 8.7% (w/w) based on the dry weight of whole-plant materials.

The extract powders were dissolved in 99.9% (v/v) DMSO (Merck, Germany) and stored at -20 °C. Before experiments, the extracts were diluted in PBS solution, then filtered by sterile 0.22-μm membranes.

Cell line culture

Two cell lines were used in this study, including AGS human gastric adenocarcinoma (ATCC, CRL-1739) and BJ-5ta human normal fibroblast immortalized with hTERT (ATCC, CRL-4001). AGS cell line was cultured in RPMI-1640 medium supplemented with 10% FBS, while BJ-5ta cell line was cultured in high glucose DMEM medium supplemented with 10% FBS. The cells were cultured in an incubator (ESCO, Singapore) at 37 °C supplied with 5% CO2 atmosphere. The culture medium was renewed every 2–3 days and cells were passaged when the confluence reached 70–80%.

Cytotoxicity assay

Firstly, cells were detached from culture surface by 0.25% trypsin- 0.53 mM EDTA, then centrifuged to obtain cell pellet. The pellet was resuspended in fresh medium and cell density was identified using Neubauer chamber (Hirschmann, Germany). After that, 100 μl of cell suspension (105 cells/mL) was transferred into each well of 96-well plate and incubated overnight. Next, the medium was replaced with fresh medium containing extracts at experimental concentrations. In initial screening step, the extract concentration of 40 μg/ml was used, while in IC50 identification step, the concentrations ranged from 0.8 to 100 μg/ml. The final concentration of DMSO in each well was kept less than 0.1% (v/v). Control untreated cells were treated with 0.1% (v/v) DMSO. Blank wells containing medium and extract (or 0.1% DMSO) were also established. The plate was incubated at 37 °C for 48 h, then 5 μl of 5 mg/ml MTT was transferred into wells. After 4-h incubation, 60 μl of lysis buffer (30% (w/v) SDS, 0.03 N HCl) and 90 μl of DMSO (99.9% (v/v)) were added. The absorbances were measured at wavelength of 550 nm. The percentage growth inhibition was calculated following the formula:

$$\mathrm{I}\%=100\%-\left({\mathrm{OD}}_{\mathrm{treated}}-{\mathrm{OD}}_{\mathrm{blank}}\right)/\left({\mathrm{OD}}_{\mathrm{control}}-{\mathrm{OD}}_{\mathrm{blank}}\right)\ \mathrm{x}\ 100\%$$

The whole assay was independently repeated in triplicate. IC50 (concentration of 50% growth inhibition) values were interpolated by GraphPad Prism 6. Meanwhile, selectivity index (SI) value was calculated by the ratio of IC50 of extract on normal cell line to IC50 of extract on cancer cell line.

Analysis of cell growth

Cells were seeded into wells at density of 105 cells/mL and treated with extract at IC50 concentration. The cell growth of treated and untreated samples was indirectly quantified through OD values of MTT assay at different time points of 0 h, 24 h, 48 h, and 72 h.

Analysis of cell morphology

Cells were seeded into wells at density of 105 cells/mL and treated with extract at IC50 concentration. Cell morphologies of treated and untreated samples were captured by inverted microscope Nikon Eclipse TiU (Nikon, Japan) after 48 h treatment.

DAPI staining and immunofluorescence staining with anti-cleaved caspase 3 antibodies

After being seeded into wells at density of 105 cells/mL, cells were treated with extract at IC50 concentration. After 48-h incubation, cells were fixed in 4% (v/v) paraformaldehyde for 10 mins, permeabilized with 0.1% (v/v) Triton-X100 for 5 mins.

For DAPI-dye staining, cells were incubated with DAPI solution (1:250 (v/v)) for 15 mins, then washed thrice with PBS solution before being visualized under a fluorescence microscope (Nikon, Japan).

For immunofluorescence staining, after the permeabilization, experimental wells were blocked by 10% (v/v) NGS for 30 mins. Subsequently, cells were incubated with anti-cleaved caspase-3 antibodies (1:200 (v/v)) for 1 h, washed thrice with PBS solution before being simultaneously incubated with secondary antibodies (1:500 (v/v)) and DAPI solution (1:250 (v/v)) for 1 h. Finally, the cells were washed with PBS solution and observed under the fluorescence microscope.

Quantitative RT-PCR

Cells were seeded into wells at density of 105 cells/mL and treated with extract at IC50 concentration. After 48-h incubation, total RNA was extracted using TriSure Kit following manufacturer’s instructions. Next, 500 ng of total RNA was converted into cDNA using Tetro cDNA synthesis Kit and oligo-dT primers. Finally, qPCR was conducted by Lightcycler 96 System (Roche Diagnostics, Germany) using SensiFAST HRM Kit and 1 μl of cDNA template. Thermal cycling conditions were as follows: 1 cycle denaturation of 95 °C for 2 mins, 45 cycles of 95 °C for 5 s, annealing temperature for 10s, 72 °C for 10s. The whole assay was independently repeated in triplicate.

Relative mRNA expression levels of treated samples compared to control samples were calculated by the formula 2-ΔΔCt. In the current study, genes including BAX, BAK, BID, APAF-1, BCL-2, TP53 were investigated, accompanied by reference gene ACTB (β-actin). Primer sequences were referred to previous documents [23,24,25,26,27]. Primer sequences were as followed: BAX-F: CAAACTGGTGCTCAAGGCCC, BAX-R: GGGCGTCCCAAAGTAGGAGA, BAK-F: TTTTCCGCAGCTACGTTTTT, BAK-R: TGGTGGCAATCTTGGTGAAGT, BID-F: TGGACTGTGAGGTCAACAACG, BID-R: AGTCTGCAGCTCATCGTAGCC, APAF1-F: CACGTTCAAAGGTGGCTGAT, APAF1-R: TGGTCAACTGCAAGGACCAT, BCL2-F: CTGGTGGACAACATCGCCCT, BCL2-R: TCTTCAGAGACAGCCAGGAGAAAT, TP53-F: GCCCAACAACACCAGCTCCT, TP53-R: CCTGGGCATCCTTGAGTTCC, ACTB-F: TCCTGTGGCATCCACGAACT, ACTB-R: GAAGCATTTGCGGTGGACGAT.

Statistical analysis

In this study, experimental data were analyzed by GraphPad Prism 6 software. The results were described as mean ± SD of at least three independent experiments. The non-linear regression curves describing the relationship between logarithm of extract concentrations and I% were established by using GraphPad Prism, from which IC50 values were interpolated by the software. The differences of mean were tested by unpaired Student’s t-test (two-tailed). The p-value less than 0.05 indicates a statistically significant difference between two groups.


Cytotoxicity of EM extracts on AGS cell line

To investigate the cytotoxicity of EM extracts, the extract concentration of 40 μg/ml was utilized. The results showed that EM-EA and EM-PE extracts exhibited remarkable inhibition (I% = 66.7 and 55.8% respectively) (Fig. 1a). Therefore, EM-EA and EM-PE extracts were subjected to IC50 analysis with concentrations ranging from 0.8 to 100 μg/ml.

Fig. 1
figure 1

The cytotoxicity of EM extracts. a The percentage growth inhibition of EM extracts at concentration of 40 μg/ml on AGS cell line. b The percentage growth inhibition of EM-EA and EM-PE extracts at experimental concentrations on AGS and BJ-5ta cell lines. Each value represents mean ± SD of at least three independent experiments. The statistical differences were analyzed by two-tailed unpaired Student’s t-tests (**p < 0.01; ****p < 0.0001; ns, p > 0.05)

At the highest concentration (100 μg/ml), EM-EA and EM-PE extract caused 67 and 90% inhibition on AGS cells; meanwhile, for the concentrations less than 10 μg/ml, the extracts exhibited no cytotoxicity (Fig. 1b). The IC50 values of EM-EA and EM-PE extracts towards AGS cell line were 27.5 and 37.2 μg/ml, respectively (Table 1). Following the criterion of National Cancer Institute (NCI), a crude extract with IC50 value less than 20–30 μg/ml is considered as having highly cytotoxic effect [16, 28]. Interestingly, EM-EA extract was less toxic to BJ-5ta normal fibroblast cell line (IC50 = 72.2 μg/ml). The selectivity index (SI) value of extract was used to emphasize the selective effect on cancer cell line compared to normal cell line [29], in which SI ≥ 2 indicates selective toxicity towards cancer cells. The SI values of EM-EA and EM-PE extracts were 2.6 and 1.0 (Table 1). Therefore, EM-EA extract was subjected to further analysis.

Table 1 The IC50 and the selectivity index values of Elephantopus mollis Kunth extracts on AGS cell line

Effect of EM-EA extract on cell growth

The AGS cell growth of EM-EA-treated samples was indirectly evaluated through OD550nm values of MTT assay. In this assay, AGS samples were treated with EM-EA extract at IC50 concentration, then OD550nm values were measured at time points of 0, 24, 48, and 72 h.

The OD550nm values of EM-EA-treated samples decreased by 18.5% at 24 h (p = 0.0394) when compared with that at 0 h and remained unchanged from 24 h to 72 h (Fig. 2a). The OD550nm values of untreated samples continuously increased. Particularly, the values at 24 h, 48 h, and 72 h increased 1.5, 1.3, and 1.4 times respectively (p = 0.0018, 0.0106, and 0.0001). The inhibitory percentages at 24, 48, and 72 h were 45.1, 53.2, and 77.3% (Fig. 2b). These results suggested that with EM-EA treatment, AGS cells might experience cell deaths or growth inhibition. To elucidate, cell morphology of EM-EA-treated samples was analyzed next.

Fig. 2
figure 2

The effects of EM-EA extract on cell growth and percentage growth inhibition of AGS cells during time. a The OD550nm values of samples treated with EM-EA extract (27.5 μg/ml) and 0.1% (v/v) DMSO (control) at different time points. b The percentage growth inhibition of EM-EA-treated samples when compared with control samples at different time points. Each value represents mean ± SD of four independent experiments. The statistical differences were analyzed by two-tailed unpaired Student’s t-tests (*p < 0.05; **p < 0.01; ***p < 0.001; ns, p > 0.05)

Effect of EM-EA extract on cell morphology

The changes of cell morphology were observed under an inverted microscope. As illustrated in Fig. 3b, for control samples, cells spread on culture surface with characteristic morphology. Meanwhile, at IC50 concentration of EM-EA extract, treated cells turned round, shrunk and be surrounded by several small bodies (Fig. 3c). These features are similar to cell morphology of apoptotic death depicted previously [30]. The percentage of cells owning abnormal morphology of EM-EA-treated samples was 28.4%, which is 5.5 times as high as that of untreated samples (5.2%) (p = 0.0215) (Fig. 3e).

Fig. 3
figure 3

The effect of EM-EA extract on cell morphology of AGS cells. a Sample at 0 h before treatment. b Control sample treated with 0.1% (v/v) DMSO at 48 h. c Sample treated with EM-EA extract (27.5 μg/ml) at 48 h. d Sample treated with doxorubicin (0.3 μg/ml) at 48 h. e The percentage of abnormal cells in cell population of control samples (n = 3), EM-EA-treated samples (n = 3), and DOX-treated samples (n = 3) at 48 h. Each value represents mean ± SD. The statistical difference was analyzed by two-tailed unpaired Student’s t-tests (*p < 0.05). (1) Images captured at 100x magnification. (2) Images captured at 400x magnification. Arrowheads point cells with abberant morphological features

Besides, in this study, doxorubicin, a chemotherapeutic agent and apoptosis inducer [31], was also used for comparison. The results showed that EM-EA-treated samples got the same morphological features as doxorubicin-treated ones (Fig. 3d). For that reason, it is suggested that cells treated with EM-EA extract might experience apoptotic deaths.

Nuclear fragmentation with EM-EA treatment

It is well-known that apoptotic cells have nuclear fragmentation [32]. Thus, to examine, EM-EA-treated samples were stained with DAPI DNA-binding dye, then visualized under fluorescence microscope.

As shown in Fig. 4b, the nuclei of EM-EA-treated samples had specific phenomena such as shrinkage, condensation, and fragmentation at locations of abnormal cells; meanwhile, for control samples, cell nuclei were fairly identical in shape and size (Fig. 4a). Besides, the nuclear shrinkage and condensation were also observed in doxorubicin-treated samples (Fig. 4c). The percentage of abnormal nuclei of EM-EA-treated samples was 20.9%, which is greater than that of untreated ones (1.1%) (p < 0.0001) (Fig. 4d). These results strongly support that EM-EA extract activated apoptotic deaths in AGS cells.

Fig. 4
figure 4

The nuclear morphology of AGS cells treated with EM-EA extract. a Control sample treated with 0.1% (v/v) DMSO at 48 h. b Sample treated with EM-EA extract (27.5 μg/ml) at 48 h. c Sample treated with doxorubicin (0.3 μg/ml) at 48 h. d The percentage of abnormal nuclei of control samples (n = 3), EM-EA-treated samples (n = 3), and DOX-treated samples (n = 2) at 48 h. Each value represents mean ± SD. The statistical difference was analyzed by two-tailed unpaired Student’s t-tests (****p < 0.0001). (1) Bright-field images. (2) Fluorescence-field images. Arrowheads and arrows point cells with abberant cell morphology and nuclear fragmentation respectively

Caspase-3 activation induced by EM-EA extract

Caspase-3, a cysteine-aspartic acid protease, is an executive enzyme which can trigger apoptotic cell death by activating other enzymes to disrupt nuclear structure, cause cell shrinkage and induce membrane blebbing. The activation of caspase-3 is considered as marker of apoptosis [33]. In our study, activated-caspase-3 signals appeared at same places with fragmented nuclei of both EM-EA-treated and doxorubicin-treated samples (Fig. 5b, c). In comparison with control untreated cells, no signal of caspase-3 activation was observed (Fig. 5a). The percentage of activated-caspase-3-expressing cells of EM-EA-treated samples was 7.3%, while that of untreated samples was 0.2% (Fig. 5d). Thus, the results demonstrate that EM-EA extract triggered apoptosis in AGS cells through caspase-3 activation.

Fig. 5
figure 5

The caspase-3 activation of AGS cells treated with EM-EA extract. a AGS control cells treated with 0.1% (v/v) DMSO at 48 h. b AGS cells treated with EM-EA extract (27.5 μg/ml) at 48 h. c AGS cells treated with doxorubicin (0.3 μg/ml) at 48 h. d The percentage of activated-caspase 3-expressing cells of control samples (n = 3), EM-EA-treated samples (n = 3), and DOX-treated samples (n = 2) at 48 h. Each value represents mean ± SD. The statistical difference was analyzed by two-tailed unpaired Student’s t-tests (****p < 0.0001). Columns (1), (2), (3), (4) represent images of cell morphology (bright field), nuclear morphology (blue), activated-caspase-3 (green), and merging of (2) and (3) (blue and green). Arrowheads, arrows, and thin arrows point abberant cell morphology, nuclear fragmentation, and caspase-3 activation respectively

The mechanism of apoptosis activation by EM-EA extract in AGS gastric cancel cells

Apoptosis can be triggered by intrinsic signaling pathway through mitochondria and/or extrinsic pathway through membrane receptors [34]. In this study, to elucidate the mechanism of apoptotic activation, the expression of pro-apoptotic (BAX, BAK, BID, APAF-1) and anti-apoptotic genes (BCL-2) was investigated by qRT-PCR.

As depicted in Fig. 6a, b, the expression levels of BID and BAX showed no difference between treated and untreated cells. Notably, BAK and APAF-1 expression levels of treated samples increased 2.57 and 2.71 times (p = 0.0029 and 0.009 respectively) when compared with those of untreated ones (Fig. 6c, d). Surprisingly, the mRNA level of BCL-2 anti-apoptotic gene was also upregulated 2.05 times (p = 0.0162) (Fig. 6e), suggesting that the treated cells had response against extract impact. In addition, we also examined the expression of TP53 gene, encoding a transcriptional factor which can take part in apoptosis through regulating pro-apoptotic genes such as BAX, BAK, APAF-1 [27, 35, 36]. However, as shown in Fig. 6f, there was no difference in TP53 expression levels between treated and untreated samples.

Fig. 6
figure 6

The mRNA levels of apoptosis-related genes of AGS cells treated with EM-EA extract (27.5 μg/ml). a-f The mRNA levels of BID, BAX, BAK, APAF-1, BCL-2, TP53 genes at 12 h. Each value represents mean ± SD of three independent experiments. The statistical differences were analyzed by two-tailed unpaired Student’s t-tests (*p < 0.05; **p < 0.01; ns, p > 0.05)

In brief, EM-EA extract might trigger apoptosis through the upregulation of BAK and APAF-1 levels in AGS cells.


Although anticancer activity of EM has been studied on liver carcinoma, lung carcinoma, leukemia cell lines, etc., no report on EM activity against gastric cancer has been published so far. Here, the cytotoxic effect of EM-EA extract on AGS gastric cancer cell line was firstly verified with IC50 of 27.5 μg/ml, which meets the criterion of highly cytotoxic crude extract (IC50 < 20–30 μg/ml) [16, 28]. Importantly, EM-EA extract was less toxic to BJ-5ta, a normal human fibroblast cell line (IC50 = 72.2 μg/ml). For chemotherapeutic treatments, beside the efficacy, side effects on normal tissues are also problems to be considered. Thus, an agent causing both selective and high toxicity on cancer cells compared with normal cells would be an ideal candidate for drug development [37]. In the current study, EM-EA extract might be a potential target for further investigation.

Following the extract effects on cell growth, cell morphology, and nuclear morphology helped to evaluate the anticancer mechanism of EM-EA extract on AGS cells. The EM-EA-treated cells experienced apoptotic deaths as evidenced by characteristic features such as cell shrinkage accompanied by small disintegrated bodies, nuclear fragmentation, and caspase-3 activation. According to previous reports, EM-EA extract could trigger apoptosis towards HepG2 liver carcinoma, A549 lung carcinoma, and HL60 leukemia cells [16, 17]. Therefore, our results add that EM-EA extract could also induce apoptosis in AGS gastric cancer cells.

Apoptotic death could be triggered by extrinsic signaling pathway through receptors on cell membrane and/or intrinsic pathway through mitochondria [34]. For extrinsic pathway, once death-inducing ligands such as FasL/TNFa/TRAIL bind to receptors on outer cell membrane, caspase 8/10 is processed, then activate caspase 3 to initiate apoptosis. For intrinsic pathway, the oligomerization of BAX, BAK proteins would be triggered to form pores on mitochondrial outer membrane leading to the release of cytochrome c which then interacts with APAF-1 to form apoptosome for caspase-3 activation. In addition, extrinsic pathway could be connected to intrinsic pathway due to the fact that activated-caspase-8 is able to cleave BID proteins causing BAX/BAK oligomerization. On the contrary, BCL-2, anti-apoptotic protein, binds to BAX/BAK to prevent the oligomerization in order to protect the integrity of mitochondrial membrane [38, 39]. In this study, with EM-EA treatment, expression levels of BAK and APAF-1 increased 2.57 and 2.71 times, while BAX and BID levels remained unchanged. It has been reported that gastric tumor has reduced-BAK levels when compared with normal mucosa, and the BAK overexpression could induce apoptosis in gastric cancer cells [40]. In addition, the increase in BAK expression indicates good chemotherapeutic response in advanced gastric cancer [41]. Therefore, our results, which recorded the upregulation of BAK mRNA level after EM-EA-extract treatment, show an optimistic sign for drug screening to treat gastric cancer. Besides, the simultaneous upregulation of BAK and APAF-1 levels also suggests that EM-EA extract might trigger apoptosis through mitochondrial pathway (Fig. 7). The mRNA expression of P53, a transcriptional factor which could regulate BAK and APAF-1 gene expression, was not different between treated and untreated samples. In this case, BAK and APAF-1 genes might be transcriptionally regulated by another factor, or P53 proteins might be regulated by post-translational modifications leading to their stable presence in cells [42] then prompting transcriptional activation of BAK and APAF-1 genes. Thus, next studies should be conducted to investigate further.

Fig. 7
figure 7

The proposed apoptotic mechanism of AGS gastric cancer cells induced by EM-EA extract

Our results also showed that with EM-EA treatment, the anti-apoptotic gene BCL-2 was upregulated 2.05-folds. As described above, the cell densities of treated samples decreased at 24 h then remained unchanged from 24 h to 72 h (Fig. 2a). Therefore, it might be that beside the population suffering apoptosis, some cells had resistant response towards the extract impact. There has also been a report on the correlation between increased BCL-2 level and the resistance of chemotherapeutic drugs such as 5-fluorouracil, adriamycin, mitomycin C in gastric cancer [43]. Importantly, despite that resistance, EM-EA extract caused a remarkable inhibition (I% = 77.3% at 72 h) and induced apoptosis in AGS cells due to the upregulation of BAK and APAF-1 expression levels.


Gastric cancer is one of the most common cancers with leading mortality rate. Screening of novel agents from natural sources, including medicinal herbs, is an approach in treatment research. In this study, ethyl acetate extract of Elephantopus mollis Kunth species was proved to be a potential candidate against gastric cancer. Specifically, EM-EA extract exhibited high cytotoxicity (IC50 = 27.5 μg/ml) and could induce apoptosis towards AGS gastric cancer cell line. The initial investigation of mechanism pointed that apoptosis activation might be triggered through mitochondrial pathway due to the upregulation of pro-apoptotic genes such as BAK and APAF-1.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.



Activated caspase-3






Elephantopus mollis Kunth


Ethyl acetate extract of Elephantopus mollis Kunth


Ethanol extract of Elephantopus mollis Kunth


Petroleum ether extract of Elephantopus mollis Kunth


Aqueous extract of Elephantopus mollis Kunth


The percentage growth inhibition

IC50 :

50% inhibitory concentration

OD550nm :

Optical density at wavelength 550 nm


Selectivity index


  1. Rawla P, Barsouk A. Epidemiology of gastric cancer: global trends, risk factors and prevention. Prz Gastroenterol. 2019;14(1):26.

    CAS  PubMed  Google Scholar 

  2. Choi IJ, Kook M-C, Kim Y-I, Cho S-J, Lee JY, Kim CG, et al. Helicobacter pylori therapy for the prevention of metachronous gastric cancer. N Engl J Med. 2018;378(12):1085–95.

    CAS  PubMed  Article  Google Scholar 

  3. Ford AC, Forman D, Hunt RH, Yuan Y, Moayyedi P. Helicobacter pylori eradication therapy to prevent gastric cancer in healthy asymptomatic infected individuals: systematic review and meta-analysis of randomised controlled trials. Bmj. 2014;348.

  4. Pasechnikov V, Chukov S, Fedorov E, Kikuste I, Leja M. Gastric cancer: prevention, screening and early diagnosis. World J Gastroenterol. 2014;20(38):13842.

    PubMed  PubMed Central  Article  Google Scholar 

  5. Orditura M, Galizia G, Sforza V, Gambardella V, Fabozzi A, Laterza MM, et al. Treatment of gastric cancer. World J Gastroenterol. 2014;20(7):1635.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  6. Deng J, Liang H, Wang D, Sun D, Pan Y, Liu Y. Investigation of the recurrence patterns of gastric cancer following a curative resection. Surg Today. 2011;41(2):210–5.

    PubMed  Article  Google Scholar 

  7. Zhang D, Fan D. New insights into the mechanisms of gastric cancer multidrug resistance and future perspectives. Future Oncol. 2010;6(4):527–37.

    CAS  PubMed  Article  Google Scholar 

  8. Power DG, Kelsen DP, Shah MA. Advanced gastric cancer–slow but steady progress. Cancer Treat Rev. 2010;36(5):384–92.

    PubMed  Article  Google Scholar 

  9. Oun R, Moussa YE, Wheate NJ. The side effects of platinum-based chemotherapy drugs: a review for chemists. Dalton Trans. 2018;47(19):6645–53.

    CAS  PubMed  Article  Google Scholar 

  10. Baker J, Ajani J, Scotté F, Winther D, Martin M, Aapro MS, et al. Docetaxel-related side effects and their management. Eur J Oncol Nurs. 2009;13(1):49–59.

    PubMed  Article  Google Scholar 

  11. Da Rocha AB, Lopes RM, Schwartsmann G. Natural products in anticancer therapy. Curr Opin Pharmacol. 2001;1(4):364–9.

    PubMed  Article  Google Scholar 

  12. Kabiru A, Por LY. Elephantopus species: traditional uses, pharmacological actions and chemical composition. Adv Life Sci Technol. 2013;15:6–13.

    Google Scholar 

  13. Nhut PM, Thao DTP. Antibacterial activity of water extract from some folk medicine at Bidoup-Nuiba National Park, Lam dong, Vietnam. SSR Inst Int J Life Sci. 2020;6(1):2449–54.

    Article  Google Scholar 

  14. Wu Z-N, Zhang Y-B, Chen N-H, Li M-J, Li M-M, Tang W, et al. Sesquiterpene lactones from Elephantopus mollis and their anti-inflammatory activities. Phytochemistry. 2017;137:81–6.

    CAS  PubMed  Article  Google Scholar 

  15. Kuete V, Fokou FW, Karaosmanoğlu O, Beng VP, Sivas H. Cytotoxicity of the methanol extracts of Elephantopus mollis, Kalanchoe crenata and 4 other Cameroonian medicinal plants towards human carcinoma cells. BMC Complement Altern Med. 2017;17(1):280.

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  16. Ooi KL, Tengku Muhammad TS, Lam LY, Sulaiman SF. Cytotoxic and apoptotic effects of ethyl acetate extract of Elephantopus mollis Kunth. In human liver carcinoma HepG2 cells through caspase-3 activation. Integr Cancer Ther. 2014;13(3):NP1–9.

    PubMed  Article  Google Scholar 

  17. Ngoc TTB, Nga NTH, Trinh NTM, Thuoc TL, Thao DTP. Elephantopus mollis Kunth extracts induce antiproliferation and apoptosis in human lung cancer and myeloid leukemia cells. J Ethnopharmacol. 2020;263:113222.

    Article  CAS  Google Scholar 

  18. Lee K-H, Ibuka T, Huang H-C, Harris DL. Antitumor agents XIV: Molephantinin, a new potent antitumor sesquiterpene lactone from Elephantopus mollis. J Pharm Sci. 1975;64(6):1077–8.

    CAS  PubMed  Article  Google Scholar 

  19. Tabopda TK, Liu J, Ngadjui BT, Luu B. Cytotoxic triterpene and sesquiterpene lactones from Elephantopus mollis and induction of apoptosis in neuroblastoma cells. Planta Med. 2007;73(04):376–80.

    CAS  PubMed  Article  Google Scholar 

  20. Ooi KL, Muhammad TST, Tan ML, Sulaiman SF. Cytotoxic, apoptotic and anti-α-glucosidase activities of 3, 4-di-O-caffeoyl quinic acid, an antioxidant isolated from the polyphenolic-rich extract of Elephantopus mollis Kunth. J Ethnopharmacol. 2011;135(3):685–95.

    CAS  PubMed  Article  Google Scholar 

  21. Li H, Li M, Wang G, Shao F, Chen W, Xia C, et al. EM23, a natural sesquiterpene lactone from elephantopus mollis, induces apoptosis in human myeloid leukemia cells through thioredoxin-and reactive oxygen species-mediated signaling pathways. Front Pharmacol. 2016;7:77.

    PubMed  PubMed Central  Google Scholar 

  22. Yang J, Li Z-D, Hou C-Y, Li Z-Y, Li Q, Miao S-Y, et al. EM-2 inhibited autophagy and promoted G 2/M phase arrest and apoptosis by activating the JNK pathway in hepatocellular carcinoma cells. Acta Pharmacol Sin. 2020;42(7):1139–49.

    PubMed  Article  CAS  Google Scholar 

  23. Amatori S, Persico G, Fanelli M. Real-time quantitative PCR array to study drug-induced changes of gene expression in tumor cell lines. J Cancer Metastasis and Treatment. 2017;3:91.

    Article  CAS  Google Scholar 

  24. Gasparotto EPL, Tognon R, Ferreira AF, Oliveira GLV, Palma PVB, Zanichelli MA, et al. Deregulated expression of A1, Bcl-2, Bcl-xL, and Mcl-1 antiapoptotic proteins and bid, bad, and Bax proapoptotic genes in polycythemia vera patients. Braz J Pharm Sci. 2011;47(4):873–86.

    CAS  Article  Google Scholar 

  25. Lund P, Kotova I, Kedinger V, Khanwalkar H, Voltz E, Hahn WC, et al. Transformation-dependent silencing of tumor-selective apoptosis-inducing TRAIL by DNA hypermethylation is antagonized by decitabine. Mol Cancer Ther. 2011;10(9):1611–23.

    CAS  PubMed  Article  Google Scholar 

  26. Xiang T, Li L, Yin X, Yuan C, Tan C, Su X, et al. The ubiquitin peptidase UCHL1 induces G0/G1 cell cycle arrest and apoptosis through stabilizing p53 and is frequently silenced in breast cancer. PLoS One. 2012;7(1):e29783.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  27. Robles AI, Bemmels NA, Foraker AB, Harris CC. APAF-1 is a transcriptional target of p53 in DNA damage-induced apoptosis. Cancer Res. 2001;61(18):6660–4.

    CAS  PubMed  Google Scholar 

  28. Itharat A, Houghton PJ, Eno-Amooquaye E, Burke P, Sampson JH, Raman A. In vitro cytotoxic activity of Thai medicinal plants used traditionally to treat cancer. J Ethnopharmacol. 2004;90(1):33–8.

    PubMed  Article  Google Scholar 

  29. Artun FT, Karagoz A, Ozcan G, Melikoglu G, Anil S, Kultur S, et al. In vitro anticancer and cytotoxic activities of some plant extracts on HeLa and Vero cell lines. J BUON. 2016;21(3):720–5.

    Google Scholar 

  30. Coleman ML, Sahai EA, Yeo M, Bosch M, Dewar A, Olson MF. Membrane blebbing during apoptosis results from caspase-mediated activation of ROCK I. Nat Cell Biol. 2001;3(4):339–45.

    CAS  PubMed  Article  Google Scholar 

  31. Eom Y-W, Kim MA, Park SS, Goo MJ, Kwon HJ, Sohn S, et al. Two distinct modes of cell death induced by doxorubicin: apoptosis and cell death through mitotic catastrophe accompanied by senescence-like phenotype. Oncogene. 2005;24(30):4765–77.

    CAS  PubMed  Article  Google Scholar 

  32. Robertson JD, Orrenius S, Zhivotovsky B. Nuclear events in apoptosis. J Struct Biol. 2000;129(2–3):346–58.

    CAS  PubMed  Article  Google Scholar 

  33. Porter AG, Jänicke RU. Emerging roles of caspase-3 in apoptosis. Cell Death Differ. 1999;6(2):99–104.

    CAS  PubMed  Article  Google Scholar 

  34. Wong RS. Apoptosis in cancer: from pathogenesis to treatment. J Exp Clin Cancer Res. 2011;30(1):1–14.

    Article  CAS  Google Scholar 

  35. Graupner V, Alexander E, Overkamp T, Rothfuss O, De Laurenzi V, Gillissen BF, et al. Differential regulation of the proapoptotic multidomain protein Bak by p53 and p73 at the promoter level. Cell Death Differ. 2011;18(7):1130–9.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  36. Thornborrow EC, Patel S, Mastropietro AE, Schwartzfarb EM, Manfredi JJ. A conserved intronic response element mediates direct p53-dependent transcriptional activation of both the human and murine bax genes. Oncogene. 2002;21(7):990–9.

    CAS  PubMed  Article  Google Scholar 

  37. López-Lázaro M. Two preclinical tests to evaluate anticancer activity and to help validate drug candidates for clinical trials. Oncoscience. 2015;2(2):91.

    PubMed  PubMed Central  Article  Google Scholar 

  38. Ku B, Liang C, Jung JU, Oh B-H. Evidence that inhibition of BAX activation by BCL-2 involves its tight and preferential interaction with the BH3 domain of BAX. Cell Res. 2011;21(4):627–41.

    CAS  PubMed  Article  Google Scholar 

  39. Dai H, Ding H, Meng XW, Lee S-H, Schneider PA, Kaufmann SH. Contribution of Bcl-2 phosphorylation to Bak binding and drug resistance. Cancer Res. 2013;73(23):6998–7008.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  40. Krajewska M, Fenoglio-Preiser CM, Krajewski S, Song K, Macdonald JS, Stemmerman G, et al. Immunohistochemical analysis of Bcl-2 family proteins in adenocarcinomas of the stomach. Am J Pathol. 1996;149(5):1449.

    CAS  PubMed  PubMed Central  Google Scholar 

  41. Kubo T, Kawano Y, Himuro N, Sugita S, Sato Y, Ishikawa K, et al. BAK is a predictive and prognostic biomarker for the therapeutic effect of docetaxel treatment in patients with advanced gastric cancer. Gastric Cancer. 2016;19(3):827–38.

    CAS  PubMed  Article  Google Scholar 

  42. Stommel JM, Wahl GM. Accelerated MDM2 auto-degradation induced by DNA-damage kinases is required for p53 activation. EMBO J. 2004;23(7):1547–56.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  43. Geng M, Wang L, Li P. Correlation between chemosensitivity to anticancer drugs and Bcl-2 expression in gastric cancer. Int J Clin Exp Pathol. 2013;6(11):2554.

    PubMed  PubMed Central  Google Scholar 

Download references


We thank to all members of Gene Technology and Application group for great supports in this study.


This research is funded by Grants-in-Aid from the JSPS Core-to-Core program, B. Asia–Africa Science Platforms; and sample collection was supported by the BiDoup – Nui Ba National Park, Vietnam.

Author information

Authors and Affiliations



TDTT carried out the investigation, formal analysis, and visualization; TTBN conducted the investigation, formal analysis, visualization, and wrote the draft; NTHN supervised the experiments; NTMT supervised the experiments; TLT supervised the experiments; DTPT designed the study, supervised the experiments, and reviewed the draft. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Dang Thi Phuong Thao.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Tam, T.D.T., Ngoc, T.T.B., Nga, N.T.H. et al. Ethyl acetate extract of Elephantopus mollis Kunth induces apoptosis in human gastric cancer cells. BMC Complement Med Ther 21, 273 (2021).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:


  • Elephantopus mollis Kunth
  • Ethyl acetate extract
  • Gastric cancer
  • Cytotoxicity
  • Apoptosis