Skip to main content

Immunomodulatory and anticancer potential of Gan cao (Glycyrrhiza uralensis Fisch.) polysaccharides by CT-26 colon carcinoma cell growth inhibition and cytokine IL-7 upregulation in vitro

Abstract

Background

Chinese licorice, (Glycyrrhiza uralensis Fisch.) is one of the commonly prescribed herbs in Traditional Chinese Medicine (TCM). Gancao, as commonly known in China, is associated with immune-modulating and anti-tumor potential though the mechanism of action is not well known. In this study, we investigated the in vitro immunomodulatory and antitumor potential of Glycyrrhiza uralensis polysaccharides fractions of high molecular weight (fraction A), low molecular weight (fraction B) and crude extract (fraction C).

Methods

Cell proliferation and cytotoxicity was investigated using Cell Counting kit 8 (CCK-8) on Intestinal epithelial cell line (IEC-6) and Colon carcinoma cell line (CT-26). IL-7 gene expression relative to GAPDH was analysed using Real time PCR. The stimulation and viability of T lymphocytes was determined by Trypan blue exclusion assay.

Results

G.uralensis polysaccharides did not inhibit proliferation of IEC-6 cells even at high concentration. The ED50 was found to be 100 μg/ml. On the other hand, the polysaccharides inhibited the proliferation of cancer cells (CT-26) at a concentration of ≤50 μg/ml. Within 72 h of treatment with the polysaccharides, expression of IL-7 gene was up-regulated over 2 times. It was also noted that, IEC-6 cells secrete IL-7 cytokine into media when treated with G.uralensis polysaccharides. The secreted IL-7 stimulated proliferation of freshly isolated T lymphocytes within 6 h. The effect of the polysaccharides were found to be molecular weight depended, with low molecular weight having a profound effect compared to high molecular weight and total crude extract.

Conclusion

Our findings indicate that G.uralensis polysaccharides especially those of low molecular weight have a potential as anticancer agents. Of great importance, is the ability of the polysaccharides to up-regulate anticancer cytokine IL-7, which is important in proliferation and maturation of immune cells and it is associated with better prognosis in cancer. Therefore, immunomodulation is a possible mode of action of the polysaccharides in cancer therapy.

Peer Review reports

Background

Cancer is a leading cause of death worldwide. According to Global cancer burden, there are estimated 12.7 million new cases and 7.6 million death, translating to 70 % increase in new cases and death [1]. It is projected that there will be an increase from 12.7 to 21.4 new cancer cases in the year 2030 [2]. In the United states, there were estimated1,665,540 new cancer cases and 585,720 cancer death in 2014 [3]. Cancer causes are complex but there are risk factors which contribute to its pathophysiology [4]. Due to this, cancer can be regarded to as a preventable disease since approximately 90–95 % of the cases are attributed to environmental factors and the remaining fraction is due to genetics. [4].

The prevention and management of cancer through surgery, radiotherapy, chemotherapy, hormonotherapy and complementary therapies have yielded varying results. Notably, conventional therapies lead to secondary complications especially metastasis, reduced immune competence, recurrence of tumors and decrease of quality of life (QOL) of patients [58]. Due to the varying effects of conventional treatments, lack of awareness and poverty, a great percentage of the world’s population uses alternative and complementary medicine for management and treatment of cancer [9, 10]. Among the complementary and alternative medicine, Traditional Chinese medicine (TCM), a holistic approach that focuses on improving body’s immune system to fight diseases, has been used to treat various diseases over thousands of years in East Asian countries. For instance, a number of different kinds of cancer have been treated with TCM drugs either alone or in combination with conventional therapies [11, 12]. Glycyrrhiza uralensis Fisch. is one of the oldest prescribed herb in Chinese traditional medicine for the treatment of various disease syndromes including cancer, by arresting tumorigenesis and metastasis [1318]. Glycyrrhiza uralensis belongs to the Family Fabaceae (Leguminosae), genus Glycyrrhiza and species Glycyrrhiza glabra, Glycyrrhiza lepidota, and Glycyrrhiza uralensis found in Europe, Asia, Russia and Turkey where its roots are commonly used. It has phenolic compounds, triterpenes, saponins, flavonoids, polysaccharides, pectines and amino acids among others [19, 20].

Studies on Glycyrrhizae have shown potential of its compounds as anticancer and immune booster in vitro and in vivo. For instance, isoliquiritigenin reduces the multiplication of colon and lung cancer [21], glycyrrhizin and glabridin have anti-proliferative and apoptosis inducing properties against MCF-7 and HEP-2 cells [22, 23], chalconeisoliquiritigenin show antitumorigenic potential on prostate and breast cancer [24, 25], 18β-glycyrrhetinic acid up-regulates T cell proliferation and enhances the immune status by increasing blood leukocyte count and weight of the spleen when administered to mice [2628].

The anti-cancer mechanism of Licorice compounds is not well known but it can be associated with augmenting T cell proliferation and modulating the immune system through stimulation and secretion of cytokine IL-7 which is associated with maturation, proliferation and maintenance of homeostasis of lymphocyte lineage cells. Research indicates that cytokines have a broad mechanism of action in cancer treatment. Due to this knowledge, a number of cytokines based therapies for cancer treatment have been developed. Among other cytokines, IL-7 has entered clinical trials for having a potential for adoptive immunotherapy in cancer therapy [2931]. Interleukin 7 induces proliferation and long-term survival of freshly isolated T cells, Naïve and memory T cells, making it an essential cytokine in lymphopoeisis and homeostasis of T lymphocytes [3234]

This study evaluated the antitumor and immunomodulatory potential of G.uralensis polysaccharides. The aim is to determine the effect of the polysaccharides on IL-7 gene expression, effect of IL-7 on proliferation of T lymphocytes and inhibitory potential of the polysaccharides on cancer cells.

Methods

All chemical reagents were purchased from Sigma (Sigma-Aldrich Inc., St. Louis, MO, USA unless otherwise stated). Mouse Intestinal Epithelial cell line (IEC-6) and colon carcinoma cell line (CT-26) were provided by Institute of animal research in Beijing, China; Dulbecco’s Modified Eagle’s Medium (DMEM), Fetal bovine serum (FBS), Streptomycin/Penicillin and Insulin were purchased from Gibco, Beijing, China; synthetic oligonucleotides primers were purchased from Sangon Biotech (Shanghai) Co., Ltd). Glycyrrhiza uralensis polysaccharide extracts were provided by the Tianjin University ofTraditional Chinese Medicine(TUTCM) herbal pharmaceutical company, Tianjin, China. The polysaccharides were fraction A of over 100 kDa was 81.4 % (High molecular weight), fraction B, of 75 kDa was 45.4 and 54.6 % polysaccharide fractions was under 10 kDa (Low molecular weight) and fraction C, 34.5 % polysaccharide fractions was 290 kDa and 14 kDa was 30.3 %, total crude extract. Cell counting kit - CCK-8 (Dojindo Molecular Technologies, Beijing, China); Trizol (Invitrogen); QuantScript RT Kit (TIANGEN, Beijing, China); SuperRealPreMix SYBR Green (TIANGEN BIOTECH (BEIJING) CO.,LTD); Microtiterplate reader, VarioskanFlash.

Cell lines and Cell culture

Mouse intestinal epithelial cell line (IEC-6) were routinely maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 1 % streptomycin/penicillin (P/S), 1 % insulin and 10 % Fetal Bovine Serum (FBS) at 37 °C and 5 % CO2. Colon carcinoma cell line (CT-26) were routinely maintained in RPMI-1640 supplemented with 1 % streptomycin/penicillin (P/S), L- glutamine and 10 % Fetal Bovine Serum (FBS) at 37 °C and 5 % CO2. All cell lines were maintained in a humidified atmosphere. Standard cell culture protocols for cell culture were followed at the TUTCM laboratories.

Antitumor and proliferative effect of G. uralensis polysaccharides

Proliferation and cytotoxicity of cells was determined using a CCK-8 assay (Dojindo Molecular Technologies, Beijing, China). A total density of approximately 5 × 103 cells/well of IEC-6 and CT-26 were seeded in 96 well plates for 24 h. They were treated with different concentrations of Licorice polysaccharides at 10 μL per well and incubated at 37 °C, 5 % CO2 for 3 days. Subsequently, 10 μL of CCK-8 was added to each well, incubated in a high humidity environment at 37 °C and 5 % CO2 for 4 h. The absorbance was measured at a wavelength of 450 nm using a microtiter plate reader (VarioskanFlash using Skanlt software 2.4.3KE).

IL-7 gene expression analysis by Real time polymerase chain reaction

To determine the immunomodulatory potential of G. uralensis polysaccharides through expression and secretion of IL-7, expression of IL–7 cytokine was evaluated by Real time PCR assay as previously described [35]. Briefly, IEC-6 cells were cultured in six well plates (2 × 105) maintained in DMEM (Gibco) supplemented with various extracts at concentrations of 100 μg/ml at 3 and 72 h. After the treatment period, RNA was isolated using RNeasy total RNA extraction Kit (Qiagen, Beijing, China). cDNA was synthesised using QuantScript RT Kit (TIANGEN, Beijing, China) according to manufacturer’s instructions. Real time PCR assay was carried out using IQ5 Multicolor thermocycler (BIO-RAD Laboratories, Beijing) using SuperReal Premix SYBR Green I (TIANGEN BIOTECH (BEIJING) CO., Ltd) following manufacturer’s TIANGEN instruction kit. The synthetic oligonucleotides primers were; IL 7: (F) 5ʹ GAGTTTCAGACGGCACACAA 3ʹ and (R) 5ʹ GAAACTTCTGGGAGGGTTCC 3ʹ (product size: 229 bp) and GAPDH: (F) 5ʹ CCACAGTCCATGCCATCAC 3ʹ and (R) 5ʹ TCCACCACCCTGTTGCTGTA 3ʹ (product size: 452 bp). The PCR conditions and amplification efficiency for the genes were optimized at 95–98 %. Two step protocol was used, 95 °C for 15 min; 95 °C for 10 s and 60 °C for 32 s followed by Dissociation curve. Expression of the gene was analysed by the IQ5 Mutlicolor Real time PCR Software as the relative expression of IL-7 of GAPDH.

Isolation of Lymphocytes and Lymphocyte activation assay

To determine secretion of IL-7 by IEC-6 cells treated with Licorice polysaccharides and proliferation of T cells stimulated by IL-7, Trypan exclusion assay and lymphocyte activation assay was done. Briefly, Rectal-orbital puncture method was used to draw blood from anaesthetised rat into anticoagulant treated tubes. A modification of lymphocyte isolation assay by density gradient centrifugation Ficoll-paque was used to isolate lymphocytes [36, 37]. The lymphocytes were cultured in supernatants of IEC-6 cells treated with G.uralensis polysaccharides, seeded in 24 well plates at a density of 1 × 104 cells/ml and ratio of 1:1. As an internal control, IL-7 mouse antibodies were added to culture wells to block stimulation by IL-7 cytokine. After 6 h of incubation, the cell number and viability was determined by Trypan blue exclusion assay.

Statistical analysis

Analysis of the results was done using SPSS statistical software version 16 and curve-fitting was done using GraphPadprism version 5. ANOVA was used to compare the means of different groups. Mean separation was carried out to determine the level of significance. The data are expressed as mean ± S.E.M. P-value of ≤ 0.05 was considered statistically significant.

Results

Proliferation of IEC-6 cells

The proliferation and viability of IEC-6 cell line was measured by (CCK-8) assay. Proliferation of cells was determined as a percentage of viable treated cells in comparison to viable untreated controls. It was determined that G.uralensis polysaccharide extracts stimulated proliferation of IEC-6 cells in vitro. The optimum growth for IEC-6 cells was found to be 1 μg/ml, however, the ED50 was determined to be approximately 100 μg/ml. Interestingly, Glycyrrhiza uralensis polysaccharides stimulated proliferation of epithelial cells even at higher concentration of 100 μg/ml. Notably, there was no significant difference between proliferation activity of the three polysaccharide fractions, but, low molecular weight polysaccharides stimulated proliferation of epithelial cells more than the high molecular weight polysaccharides (Fig. 1). Furthermore, licorice polysaccharides showed little or no cytotoxic effects on the epithelial cells unless at obviously very high concentration.

Fig. 1
figure 1

Effect of polysaccharides on IEC-6 viability and proliferation. IEC-6 cells (5 × 104cells/ml) stimulated by polysaccharides (Fraction a, b & c) with concentration range of 0.001 μg/ml to 100 μg/ml for 72 h at 37°C, 5 % CO2- Cell viability measured by CCK-8 assay. Data expressed as mean ± S.E.M of three tests done in triplicate

G.uralensis polysaccharides inhibits proliferation of colon carcinoma cell line (CT-26)

We investigated whether G.uralensis polysaccharides has the same effect of promoting proliferation of epithelial cells on cancer cell lines. Colon cancer cell line (CT-26) was treated with different concentrations of G.uralensis polysaccharides. The polysaccharides showed significant antitumor effects after 72 h. At a concentration of 0.05 mg/ml, growth inhibition was evident (Fig. 2) with nearly 50 % growth inhibition of cancer cells compared to epithelial cells, IEC-6, (Fig. 2). Comparing the three extracts, Fraction B, which is polysaccharide of lower molecular weight showed a higher inhibitory activity than the other fractions, A and C with more than 50 % of the growth inhibition of CT-26 cells at 0.1 mg/ml (Fig. 2). The results indicate that, while the licorice polysaccharides stimulate proliferation of normal cells (IEC-6), they inhibit growth of cancer cells even at low concentration.

Fig. 2
figure 2

In vitro direct cytotoxic effect of Gancao polysaccharide extracts. Decrease in cell number was observed in CT 26 cells (5 × 104 cells /ml) upon treatment with various concentration of polysaccharides (Fraction a, b and c) from 0.05 mg/ml to 0.8 mg/ml as measured by CCK-8 assay. Data expressed as mean ± SEM of three experiments. *P < 0.05, **P < 0.01 versus control

G.uralensis polysaccharides up-regulates expression of Interleukin 7

To investigate the immunomodulatory effect of G.uralensis polysaccharides through upregulation of IL-7 gene, the expression level of IL-7 in licorice polysaccharide treated IEC-6 cells was determined. The IEC-6 cells treated with G.uralensis polysaccharides showed up-regulation of the IL-7 gene after 3 h and the upregulation remained elevated upto 72 h of treated. The up regulation of these cytokine was depended on the molecular weight of the extracts, going up by over two times with fraction B (Fig. 3). The up-regulation of the cytokine was not time dependent, at 3 and 72 h, the up-regulation was not significantly different (Fig. 3a and b).

Fig. 3
figure 3

Expression of IL 7mRNA at (a) 3 h and (b) 72 h. 100 μg/ml of each polysaccharide fraction was added to IEC-6 cells and incubated for 3 and 72 h respectively. The normalized relative expression of IL-7 mRNA was analyzed by IQ5 Real-time PCR software. Data presented as mean ± S.E.M. *P < 0.05 versus untreated (control) of three experiments

Interleukin 7 enhances T lymphocyte proliferation

We sought to establish whether the activation and proliferation of T lymphocytes was due to secreted interleukin 7. After a 6 h incubation of the T lymphocytes with various supernatants derived from IEC-6 cells treated with G.uralensis polysaccharides, the T lymphocytes number was determined as a measure of activation and proliferation. From the results, all supernatants of IEC-6 cells treated with G.uralensis polysaccharide showed a slight increase in number of T lymphocytes (Fig. 4). Low molecular weight polysaccharide Fraction B, showed a higher proliferation activity among the three fractions, though there was no significant difference between these fractions.

Fig. 4
figure 4

Activation and proliferation of T lymphocytes by secreted IL-7 Freshly isolated T lymphocytes maintained in supernatants of IEC-6 polysaccharide treated cells. Data represented as mean ± S.E. of two experiments

Discussion

This study focused on determining the anticancer potential of polysaccharides from Chinese licorice which is a major guiding drug in many Chinese herbal prescriptions. Immunomodulation has been recognised as an important molecular mechanism targeting control of cancers especially by use of cytokines.

Glycyrrhiza uralensis has been used and fronted as an anticancer agent. Apart from its pharmacological application, Gancao, as known in China, has been used as a flavoring agent and sweetening agent in tobaccos, chewing gums, candies, and toothpaste among other uses [38, 39]. G. uralensis is used as a flavouring agent to disguise the unpleasant taste and smell of other drugs. Apart from the medicinal properties, Gan cao is used as food, a reason that can be attributed to the non toxicity of its polysaccharides on gut mucosal cells. This was confirmed from our study where the Gancao polysaccharides showed no cytotoxic effects on normal gut cells, IEC-6 cells (Fig. 1). It was observed that the polysaccharides fraction from Gan cao stimulated proliferation of Intestinal epithelial cells. These polysaccharides are therefore safe for consumption both as dietary suppliments or food and herbal prescriptions.

G. uralensis is used in the treatment of various diseases [40]. In Japan and China, apart from its pharmaceutical application, it is used as a sweetening and flavouring agent in pharmaceutical industries. It is used to treat various ailments and diseases including cancer. The mechanism of action in cancer treatment are varied including apoptotic cell death through upregulation of p53 and p21, cell cycle arrest, suppression of nitric oxide production among others [4144]. The antitumor activity of Gan cao was evident when tumor cells (CT-26 cells) were exposed to these polysaccharides. The cell growth was inhibited even at low concentration of 0.05 mg/ml. The inhibition was dependent on the molecular weight of the polysaccharides with low molecular weight polysaccharides showing a higher growth inhibition compared to the other polysaccharides (Fig. 2). It is therefore paramount to link Gan cao polysaccharides to direct activity on tumor cells. This antitumor activity is true for polysaccharides especially low molecular weight polysaccharides which have been proven to have immunomodulation and antitumor activity [45]. Though it has been shown that polysaccharides do not have direct effect on cancer cells (Wasser 2002), our study showed that Licorice polysaccharide directly inhibited growth of CT-26 tumor cells but not IEC 6 cells in vitro at a concentration of 0.05 mg/ml. Fraction B of low molecular weight inhibited proliferation of CT-26 cells in a dose-dependent manner and at less than 0.1 mg/ml concentration, its cytotoxicity effect was half in comparison to other fractions. The results concurred with earlier findings confirming the antitumor potential of Gan cao polysaccharides [4648].

Gan cao has previously been associated with anticancer, antioxidant and anti-inflammatory effects. Among its mode of action, immunomodulation has been exhibited by Gancao [42, 49, 50]. The effect of Gan cao polysaccharide on IL-7 has not been explored. IL-7 is an important cytokine in cancer immunotherapy and it has potential for adoptive immunotherapy [51]. Interleukin 7 homeostasis determines host survival and is an indicator of host immunocompetence. Increased levels of IL-7 leads to T cell activation and lack of IL-7 leads to severe immunodeficiency [52, 53]. A part from bone marrow and other sites of production, intestinal epithelial cells have recently been identified as a major site of secretion [5456]. From our experiments, epithelial cells cultured with licorice polysaccharides up-regulated the expression of IL-7 cytokine. The expression was elevated at 3 h and remained elevated up to 72 h by two times compared to the untreated controls (Fig. 3). Augmented expression of IL-7 translates to increased circulation of IL-7 protein. IL-7 produced in the gut initiates local immune response and promote overall immune activity to pathogens through stimulation and maturation of T lymphocytes [57]. Cytokines like IL-7, when secreted, stimulate immune effector cells and enhance tumor cell recognition by cytotoxic effector cells [31]. The elevated expression of IL-7 cytokine therefore is an indicator of the immunomodulatory potential of Gancao polysaccharides. Earlier research has shown, in vitro and in vivo, IL-7 is responsible for development, maturation, proliferation and homeostasis of T lymphocytes [58, 59]. These findings are in agreement with our results, in which freshly isolated T lymphocytes cultured in supernatants containing secreted IL-7, though to a slight extend, enhanced proliferation of lymphocytes. We can therefore confirm that, IL-7 secreted by IEC 6 cells treated with Gan cao polysaccharides can enhance proliferation of T lymphocytes (Fig. 4). The proliferation of T lymphocytes leads to CD4+ and CD8+ infiltration of tumors which is associated with better prognosis [60]. Furthermore, histology of tumors from IL-7–treated mice show heavy infiltration with both CD4+ and CD8+ T cells [61]. Protection against tumor progression and metastasis is attributed to cellular immunity due to CD4+ nad CD8+ cells [62]. Population and function of tumor specific CTL are enhanced by presence of tumor specific CD4+ T cell responses, their lack leads to tumor progression and abrogates the survival of tumor bearing hosts. It involves CD8+ as key effector cells of which CD4+ plays an important role in their production, expansion maintenance and activation. The end results of combined CD4+ and CD8+ is better than one, though CD4+ is essential for effective antitumor CTL responses by enhancing their number and function. In addition to enhancing responses of CD8+ T cell responses, CD4+ mediate tumor rejection through cytotoxic effect on tumor cells, up regulation of MHC molecules expression, inhibition of angiogenesis and induction of tumor dormancy [63, 64]. It is therefore paramount that the upregulation of IL-7 leads to augmentation of T lymphocytes which are important in cancer immunotherapy.

Conclusion

A major finding of our research is that licorice polysaccharides have an antitumor and immunomodulatory activity. They stimulate proliferation of IEC-6 cells which are major sites of IL-7 production. These polysaccharides have a direct antitumor potential as they inhibit proliferation of tumor cells, CT-26, even at low concentration. Immunomodulatory potential of these polysaccharides is exhibited through up-regulation of the relative expression of IL-7 gene, the immune cytokine, IL-7. This cytokine has been fronted for enhancement, maturation, proliferation and long survival of immune effector T cells. Finally, Gan cao polysaccharides can enhance secretion of IL-7 cytokine by IEC-6, which subsequently indicates that this cytokine has the potential of promoting proliferation of T lymphocytes. From these finding, we can therefore propose that Gan cao polysaccharides have direct anticancer potential on tumor cells and also have immunomodulatory potential through upregulation of IL-7 cytokine, which research has shown to play a major role in cancer immunotherapy.

Abbrevations

ANOVA, analysis of variance; CCK, cell counting kit; CD, cluster of differentiation; cDNA, complementary deoxyribonucleic acid; CO2, carbon dioxide; DMEM, Dulbecco’s Modified Eagle’s Medium; ED, effective dose; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IEC, intestinal epithelial cells; IL, interleukin; kDa, kilodalton; P/S, penicillin/streptomycin; PCR, polymerase chain reaction; RNA, ribonucleic acid; RPMI, Roswell Park Memorial Institute; SEM, standard error mean; TCM, traditional Chinese medicine; TUTCM, Tianjin University of Traditional Chinese Medicine

References

  1. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J cancer. 2010;127(12):2893–917.

    Article  CAS  PubMed  Google Scholar 

  2. Bray F, Jemal A, Grey N, Ferlay J, Forman D. Global cancer transitions according to the Human Development Index (2008–2030): a population-based study. Lancet Oncol. 2012;13(8):790–801.

    Article  PubMed  Google Scholar 

  3. Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin. 2014;64(1):9–29.

    Article  PubMed  Google Scholar 

  4. Anand P, Kunnumakkara AB, Sundaram C, Harikumar KB, Tharakan ST, Lai OS, Sung B, Aggarwal BB. Cancer is a preventable disease that requires major lifestyle changes. Pharm Res. 2008;25(9):2097–116.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Ouhtit A, Gaur RL, Abdraboh M, Ireland SK, Rao PN, Raj SG, Al-Riyami H, Shanmuganathan S, Gupta I, Murthy SN. Simultaneous inhibition of cell-cycle, proliferation, survival, metastatic pathways and induction of apoptosis in breast cancer cells by a phytochemical super-cocktail: genes that underpin its mode of action. J Cancer Educ. 2013;4(9):703.

    Article  CAS  Google Scholar 

  6. von Freeden-Jeffry U, Vieira P, Lucian LA, McNeil T, Burdach SE, Murray R. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J Exp Med. 1995;181(4):1519–26.

    Article  Google Scholar 

  7. PU CY, Lan V, LAN CF LANGHC. The determinants of traditional Chinese medicine and acupuncture utilization for cancer patients with simultaneous conventional treatment. Eur J Cancer Care. 2008;17(4):340–9.

    Article  Google Scholar 

  8. von Gruenigen VE, Frasure HE, Jenison EL, Hopkins MP, Gil KM. Longitudinal assessment of quality of life and lifestyle in newly diagnosed ovarian cancer patients: the roles of surgery and chemotherapy. Gynecol Oncol. 2006;103(1):120–6.

    Article  Google Scholar 

  9. Jin X, Ruiz Beguerie J, Sze DMy, Chan GC. Ganoderma lucidum (Reishi mushroom) for cancer treatment. Cochrane Libr 2012.

  10. FACT SHEET. Retrived December 12, 2014. From http://www.who.int/mediacentre/factsheets/2003/fs134/en/

  11. Lu AP, Jia HW, Xiao C, Lu QP. Theory of traditional Chinese medicine and therapeutic method of diseases. WJG. 2004;10(13):1854–6.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Li X, Yang G, Li X, Zhang Y, Yang J, Chang J, Sun X, Zhou X, Guo Y, Xu Y. Traditional Chinese medicine in cancer care: a review of controlled clinical studies published in Chinese. PLoS One. 2013;8(4):e60338.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Yo Y-T, Shieh G-S, Hsu K-F, Wu C-L, Shiau A-L. Licorice and licochalcone-A induce autophagy in LNCaP prostate cancer cells by suppression of Bcl-2 expression and the mTOR pathway. J Agric Food Chem. 2009;57(18):8266–73.

    Article  CAS  PubMed  Google Scholar 

  14. Dong S, Inoue A, Zhu Y, Tanji M, Kiyama R. Activation of rapid signaling pathways and the subsequent transcriptional regulation for the proliferation of breast cancer MCF-7 cells by the treatment with an extract of Glycyrrhiza glabra root. Food Chem Toxicol. 2007;45(12):2470–8.

    Article  CAS  PubMed  Google Scholar 

  15. Huang KC. The pharmacology of Chinese herbs. Boca Raton, USA: CRC press; 1998.

  16. Wang X, Zhang H, Chen L, Shan L, Fan G, Gao X. Liquorice, a unique “guide drug” of traditional Chinese medicine: a review of its role in drug interactions. J Ethnopharmacol. 2013;150(3):781–90.

    Article  CAS  PubMed  Google Scholar 

  17. Dong J. The relationship between traditional Chinese medicine and modern medicine. Evid Based Complement Alternat Med. 2013;2013:153148.

    PubMed  PubMed Central  Google Scholar 

  18. Ling CQ, Yue XQ, Ling C. Three advantages of using traditional Chinese medicine to prevent and treat tumor. J Integr Med. 2014;12(4):331–5.

    Article  PubMed  Google Scholar 

  19. Zhang Q, Ye M. Chemical analysis of the Chinese herbal medicine Gan-Cao (licorice). J Chromatogr A. 2009;1216(11):1954–69.

    Article  CAS  PubMed  Google Scholar 

  20. Kang HR, Seo JY, Kim SS, Kim BR, Zakharova A, Woo JE, Kim MH, Han MK, Kim J-S: Anti-inflammatory activities of licorice-derived prenylflavonoids (830.30). FASEB J.2014, 28(1 Supplement):830.

  21. Chin YW, Jung HA, Liu Y, Su BN, Castoro JA, Keller WJ, Pereira MA, Kinghorn AD. Anti-oxidant constituents of the roots and stolons of licorice (Glycyrrhiza glabra). J Agric Food Chem. 2007;55(12):4691–7.

    Article  CAS  PubMed  Google Scholar 

  22. Rossi T, Castelli M, Zandomeneghi G, Ruberto A, Benassi L, Magnoni C, Santachiara S, Baggio G. Selectivity of action of glycyrrhizin derivatives on the growth of MCF-7 and HEP-2 cells. Anticancer Res. 2003;23(5A):3813–8.

    CAS  PubMed  Google Scholar 

  23. Tamir S, Eizenberg M, Somjen D, Stern N, Shelach R, Kaye A, Vaya J. Estrogenic and antiproliferative properties of glabridin from licorice in human breast cancer cells. Cancer Res. 2000;60(20):5704–9.

    CAS  PubMed  Google Scholar 

  24. Maggiolini M, Statti G, Vivacqua A, Gabriele S, Rago V, Loizzo M, Menichini F, Amdo S. Estrogenic and antiproliferative activities of isoliquiritigenin in MCF7 breast cancer cells. J Steroid Biochem Mol Biol. 2002;82(4–5):315–22.

    Article  CAS  PubMed  Google Scholar 

  25. Kanazawa M, Satomi Y, Mizutani Y, Ukimura O, Kawauchi A, Sakai T, Baba M, Okuyama T, Nishino H, Miki T. Isoliquiritigenin inhibits the growth of prostate cancer. Eur Urol. 2003;43(5):580–6.

    Article  CAS  PubMed  Google Scholar 

  26. Mitra Mazumder P, Pattnayak S, Parvani H, Sasmal D, Rathinavelusamy P. Evaluation of immunomodulatory activity of < i > Glycyrhiza glabra</i > L roots in combination with zing. Asian Pacific J Trop Biomed. 2012;2(1):S15–20.

    Article  Google Scholar 

  27. Sasaki H, Suzuki N, Alshwaimi E, Xu Y, Battaglino R, Morse L, Stashenko P. 18beta-glycyrrhetinic acid inhibits periodontitis via glucocorticoid-independent nuclear factor-kappaB inactivation in interleukin-10-deficient mice. J Periodontal Res. 2010;45(6):757–63.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Hendricks JM, Hoffman C, Pascual DW, Hardy ME. 18β-glycyrrhetinic acid delivered orally induces isolated lymphoid follicle maturation at the intestinal mucosa and attenuates rotavirus shedding. 2012.

    Google Scholar 

  29. Feng CG, Zheng L, Jankovic D, Báfica A, Cannons JL, Watford WT, Chaussabel D, Hieny S, Caspar P, Schwartzberg PL. The immunity-related GTPase Irgm1 promotes the expansion of activated CD4+ T cell populations by preventing interferon-γ-induced cell death. Nat Immunol. 2008;9(11):1279–87.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Kennedy R, Celis E. Multiple roles for CD4+ T cells in anti‐tumor immune responses. Immunol Rev. 2008;222(1):129–44.

    Article  CAS  PubMed  Google Scholar 

  31. Lee S, Margolin K. Cytokines in Cancer Immunotherapy. Cancers. 2011;3(4):3856.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Cimbro R, Vassena L, Arthos J, Cicala C, Kehrl JH, Park C, Sereti I, Lederman MM, Fauci AS, Lusso P. IL-7 induces expression and activation of integrin α4β7 promoting naive T-cell homing to the intestinal mucosa. Blood. 2012;120(13):2610–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Simonetta F, Gestermann N, Martinet KZ, Boniotto M, Tissieres P, Seddon B, Bourgeois C. Interleukin-7 influences FOXP3+ CD4+ regulatory T cells peripheral homeostasis. PLoS One. 2012;7(5):e36596.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Sheikh V, Porter BO, DerSimonian R, Kovacs SB, Thompson WL, Perez-Diez A, Freeman AF, Roby G, Mican J, Pau A: Administration of interleukin-7 increases CD4 T cells in idiopathic CD4 lymphocytopenia. Blood 2016:127;977-88.

  35. Citri A, Pang ZP, Sudhof TC, Wernig M, Malenka RC. Comprehensive qPCR profiling of gene expression in single neuronal cells. Nat Protoc. 2012;7(1):118–27.

    Article  CAS  Google Scholar 

  36. Ferreira MCMR, Foltran RK, Santucci R, Lage LAPC, Levy D, Pereira J. CD4+ Lymphocytes in Asymptomatic HTLV-1 Carriers Present Cell Cycle Arrest in G0/G1-Phase. Blood. 2014;124(21):5377.

    Google Scholar 

  37. Nilsson C, Aboud S, Karlen K, Hejdeman B, Urassa W, Biberfeld G. Optimal blood mononuclear cell isolation procedures for gamma interferon enzyme-linked immunospot testing of healthy Swedish and Tanzanian subjects. Clin Vaccine Immunol. 2008;15(4):585–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Wang ZY, Nixon DW. Licorice and cancer. Nutr Cancer. 2001;39(1):1–11.

    Article  CAS  PubMed  Google Scholar 

  39. Asl MN, Hosseinzadeh H. Review of pharmacological effects of Glycyrrhiza sp. and its bioactive compounds. Phytother Res. 2008;22(6):709–24.

    Article  CAS  PubMed  Google Scholar 

  40. Parvaiz M, Hussain K, Khalid S, Hussnain N, Iram N, Hussain Z, Ali MA. A review: Medicinal importance of Glycyrrhiza glabra L. (Fabaceae family). Global J Pharmacol. 2014;8(1):8–13.

    CAS  Google Scholar 

  41. Tanemoto R, Okuyama T, Matsuo H, Okumura T, Ikeya Y, Nishizawa M. The constituents of licorice (Glycyrrhiza uralensis) differentially suppress nitric oxide production in interleukin-1β-treated hepatocytes. Biochemistry Biophysics Rep. 2015;2:153–9.

    Article  Google Scholar 

  42. Bode AM, Dong Z. Chemopreventive Effects of Licorice and Its Components. Current Pharmacol Rep. 2015;1(1):60–71.

    Article  Google Scholar 

  43. Zhou Y, Ho WS. Combination of liquiritin, isoliquiritin and isoliquirigenin induce apoptotic cell death through upregulating p53 and p21 in the A549 non-small cell lung cancer cells. Oncol Rep. 2014;31(1):298–304.

    CAS  PubMed  Google Scholar 

  44. Seon MR, Park SY, Kwon SJ, Lim SS, Choi HJ, Park H, Kim J-S, Lee CH, Kim J, Park JHY. Hexane/ethanol extract of Glycyrrhiza uralensis and its active compound isoangustone A induce G1 cycle arrest in DU145 human prostate and 4T1 murine mammary cancer cells. J Nutr Biochem. 2012;23(1):85–92.

    Article  CAS  PubMed  Google Scholar 

  45. Sun L, Wang L, Zhou Y. Immunomodulation and antitumor activities of different-molecular-weight polysaccharides from Porphyridium cruentum. Carbohydr Polym. 2012;87(2):1206–10.

    Article  CAS  Google Scholar 

  46. Jo EH, Hong HD, Ahn NC, Jung JW, Yang SR, Park JS, Kim SH, Lee YS, Kang KS. Modulations of the Bcl-2/Bax family were involved in the chemopreventive effects of licorice root (Glycyrrhiza uralensis Fisch) in MCF-7 human breast cancer cell. J Agric Food Chem. 2004;52(6):1715–9.

    Article  CAS  PubMed  Google Scholar 

  47. Chen J, Jin X, Chen J, Liu C. Glycyrrhiza polysaccharide induces apoptosis and inhibits proliferation of human hepatocellular carcinoma cells by blocking PI3K/AKT signal pathway. Tumor Biol. 2013;34(3):1381–9.

    Article  CAS  Google Scholar 

  48. Hosseinzadeh H, Nassiri‐Asl M. Pharmacological Effects of Glycyrrhiza spp. and Its Bioactive Constituents: Update and Review. Phytother Res. 2015;29(12):1868–86.

    Article  PubMed  Google Scholar 

  49. Li X-L, Zhou A-G. Evaluation of the immunity activity of glycyrrhizin in AR mice. Molecules. 2012;17(1):716–27.

    Article  CAS  PubMed  Google Scholar 

  50. Jayaprakasam B, Yang N, Wen M-C, Wang R, Goldfarb J, Sampson H, Li X-M. Constituents of the anti-asthma herbal formula ASHMI™ synergistically inhibit IL-4 and IL-5 secretion by murine Th2 memory cells, and eotaxin by human lung fibroblasts in vitro. J Intern Med. 2013;11(3):195–205.

    CAS  Google Scholar 

  51. Sarangi I, Ghosh D, Bhutia SK, Mallick SK, Maiti TK. Anti-tumor and immunomodulating effects of Pleurotus ostreatus mycelia-derived proteoglycans. Int Immunopharmacol. 2006;6(8):1287–97.

    Article  CAS  PubMed  Google Scholar 

  52. Morre M, Beq S. Interleukin-7 and immune reconstitution in cancer patients: a new paradigm for dramatically increasing overall survival. Target Oncol. 2012;7(1):55–68.

    Article  PubMed  PubMed Central  Google Scholar 

  53. Lundström W, Fewkes NM, Mackall CL. IL-7 in human health and disease. In: Seminars in immunology: Amsterdam, Netherlands; 2012: Elsevier; 2012: 218–224.

  54. Zhang W, Du J-Y, Yu Q, Jin J-O. Interleukin-7 Produced by Intestinal Epithelial Cells in Response to Citrobacter rodentium Infection Plays a Major Role in Innate Immunity against This Pathogen. Infect Immun. 2015;83(8):3213–23.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  55. Ciccia F, Guggino G, Rizzo A, Saieva L, Peralta S, Giardina A, Cannizzaro A, Sireci G, De Leo G, Alessandro R. Type 3 innate lymphoid cells producing IL-17 and IL-22 are expanded in the gut, in the peripheral blood, synovial fluid and bone marrow of patients with ankylosing spondylitis. Ann. Rheum. Dis.2015:annrheumdis-2014-206323.

  56. Shalapour S, Deiser K, Sercan O, Tuckermann J, Minnich K, Willimsky G, Blankenstein T, Hammerling GJ, Arnold B, Schuler T. Commensal microflora and interferon-gamma promote steady-state interleukin-7 production in vivo. Eur J Immunol. 2010;40(9):2391–400.

    Article  CAS  PubMed  Google Scholar 

  57. Hou L, Jie Z, Liang Y, Desai M, Soong L, Sun J. Type 1 interferon-induced IL-7 maintains CD8&plus; T-cell responses and homeostasis by suppressing PD-1 expression in viral hepatitis. Cell Mol Immunol. 2015;12(2):213–23.

    Article  CAS  PubMed  Google Scholar 

  58. Seddon B. Thymic IL-7 signaling goes beyond survival. Nat Immunol. 2015;16(4):337–8.

    Article  CAS  PubMed  Google Scholar 

  59. Okoye AA, Rohankhedkar M, Konfe AL, Abana CO, Reyes MD, Clock JA, Duell DM, Sylwester AW, Sammader P, Legasse AW. Effect of IL-7 therapy on naive and memory T cell homeostasis in aged rhesus macaques. J Immunol. 2015;195(9):4292–305.

    Article  CAS  PubMed  Google Scholar 

  60. Klebanoff CA, Acquavella N, Yu Z, Restifo NP. Therapeutic cancer vaccines: are we there yet? Immunol Rev. 2011;239(1):27–44.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  61. Pellegrini M, Calzascia T, Elford AR, Shahinian A, Lin AE, Dissanayake D, Dhanji S, Nguyen LT, Gronski MA, Morre M, et al. Adjuvant IL-7 antagonizes multiple cellular and molecular inhibitory networks to enhance immunotherapies. Nat Med. 2009;15(5):528–36.

    Article  CAS  PubMed  Google Scholar 

  62. Zanetti M. Tapping CD4 T Cells for Cancer Immunotherapy: The Choice of Personalized Genomics. J Immunol. 2015;194(5):2049–56.

    Article  CAS  PubMed  Google Scholar 

  63. Berzofsky JA, Wood LV, Terabe M: Strategies for Improving Vaccines to Elicit T Cells to Treat Cancer. In: Developments in T Cell Based Cancer Immunotherapies. edn.: Springer International Publishing, Switzerland; Springer; 2015: 29–52.

  64. Assudani DP, Horton RB, Mathieu MG, McArdle SE, Rees RC. The role of CD4+ T cell help in cancer immunity and the formulation of novel cancer vaccines. Cancer Immunol Immunother. 2007;56(1):70–80.

    Article  PubMed  Google Scholar 

Download references

Acknowledgement

This research was supported by the Chinese Scholarship Council (CSC), through the International Education College, Tianjin University of Traditional Chinese Medicine (TUTCM) PR. China. I wish to acknowledge my employer, Egerton University, Njoro, Kenya, for granting me a chance of 3 year study leave to do research.

Funding

Not applicable

Availability of data and materials

The main data are presented in this article in form of figures and datasets supporting conclusions are included as Additional file 1.

Authors’ contribution

PAA designed the study and did experimental work and analyses. PGM and RU collaborated in carrying out experimental work. BYH, CXQ and ZYZ collaborated in designing the study and supervised the work. EOO did analyses of the work and all authors contributed to the manuscript preparation, reading and approval for submitting.

Competing interest

All authors declare there are no competing interests, financial/commercial or any conflict of interest.

Consent for publication

All authors gave consent for submission and publication of the manuscript.

Ethics approval and consent to participate

Not applicable.

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Yuhong Bian.

Additional file

Additional file 1:

Availability of data and materials. (XLS 40 kb)

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Ayeka, P.A., Bian, Y., Mwitari, P.G. et al. Immunomodulatory and anticancer potential of Gan cao (Glycyrrhiza uralensis Fisch.) polysaccharides by CT-26 colon carcinoma cell growth inhibition and cytokine IL-7 upregulation in vitro. BMC Complement Altern Med 16, 206 (2016). https://doi.org/10.1186/s12906-016-1171-4

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12906-016-1171-4

Keywords

  • Glycyrrhiza uralensis
  • Immunomodulatory
  • TCM
  • Anti-cancer
  • IL-7
  • Polysaccharides