Materials All materials were obtained from Huaxia Biotech (Beijing, China) unless stated otherwise.
Animals Healthy male rats (n = 3) with average weight of 280-300 grams at 50-60 days of age were obtained from the Central Animal Services, Fudan University. Animals were euthanized by CO2 inhalation followed by cervical dislocation. All animal procedures were performed with approval of the Fudan University institutional animal care and use committee and in conformity with the guidelines for the care and use of laboratory animals formulated by the Ministry and Science and Technology of China (The Ministry and Science and Technology of the People’s Republic of China, Beijing, China, 2006).
AM solution preparation AM injection was purchased from Wu Jing Hospital (Shanghai, China), and each was loaded 100 mL which was equivalent to 20 grams of raw herb. AM injection was diluted in dimethyl sulfoxide (DMSO) (Sigma, Shanghai, China) at 10 μg/mL, 20 μg/mL, 50 μg/mL, 100 μg/mL and 150 μg/mL respectively for cell culture.
Isolation and purification of rat Leydig cells Testes were excised sterilely from male rats (n = 3) following euthanasia and placed in PBS (pH 7.0-7.2). After washing 2 times with PBS, the testes were placed in DMEM. After removing the epididymis, fat and tunica albuginea, the testes were shredded into small pieces and transferred to a 50 mL centrifuge tube containing DMEM. Leydig cells were dispersed by pipetting followed by centrifugation at 800 rpm for 10 min at 4 °C. Pellet was resuspended in medium followed by centrifugation twice at 600 rpm and 4 °C for 2 min. Supernatant was collected and the cells were seeded into culture dishes for 12 h at 37 °C with 5 % CO2. Culture medium was then replaced and cells cultured for another 12 h with Leydig cell purity assessed as described below.
3β-hydroxysteroid dehydrogenase (3β-HSD) staining The purity of cells was determined by 3β-HSD staining. After above described 24 h culture, media was removed and cells were removed from culture dish and placed in suspension. The Leydig cell suspension was incubated for 1 h at 37 °C with 1 mg/mL NBT (nitroblue tetrazolium), 3 mg/mL NAD+ (Nicotinamide Adenine Dinucleotide), 2 mg/mL DHEA (dehydroepiandrosterone) and1.6 mg/mL nicotinamide in 0.1 M PBS (Phosphate Buffered Saline). Stained cells were washed with PBS once and fixed in 10 % formaldehyde - 50 % ethanol (v/v) for 30 min, after which the cells were sedimented and washed two times. A drop of resuspended cell suspension was placed on a glass microscope slide. After drying, the percent of positive cells with a distinct blue reaction product were observed under a microscope (Olympus, Hong Kong, China).
Culture of Leydig cells and AM treatment Purified Leydig cells were seeded in either 96-well culture plates (3 × 103 cells/well) or 24-well culture plates (2 × 104 cells/well) and cultured in 90 % DMEM plus 10 % FBS and 1 % Penicillin-Streptomycin solution at 37 °C and 5 % CO2. Treatments consisted of culture medium without (control group with equivalent DMSO instead of AM injection) or with different concentrations of AM injection (10 μg/mL, 20 μg/mL, 50 μg/mL, 100 μg/mL, 150 μg/mL). 48 h after treatment, the cells and/or culture medium were collected and used in various assays described below. All experiments were repeated 3 times using testes obtained from different rats on different days.
Cell proliferation assay Cell proliferation was detected using a CCK-8 (cell counting kit-8) assay kit according to the manufacturer’s instructions (Dojindo, Shanghai, China). After above described 48 h culture, the culture medium was collected and Leydig cells were washed two times with 0.1 M PBS. Then 10 μL of CCK-8 reagent was added to each well and incubated at 37 °C for 2 h. The WST–8 (2 - (2 - methoxy - 4 - (phenyl) - 3 - (4 - (phenyl) - 5 - (2, 4 - sulpho benzene) - 2 H - tetrazolium monosodium salt) in the reagent can be reduced to orange-yellow formazan by dehydrogenase, which is proportional to the number of viable cells. Absorbance at 450 nm was recorded using a microplate reader (Thermo Scientific, Shanghai, China). A standard curve was designed using Leydig cell suspension with different dilution rates to calculate the viable cell numbers in each sample.
Testosterone Enzyme-Linked Immunosorbent assay (ELISA) Concentrations of testosterone in culture medium were detected using a Rat Free testosterone ELISA kit following the manufacturer’s instructions (Zhongtianjingwei Science and Technology Co., LTD, Beijing, China). The ELISA plates were read with a microplate reader (Thermo Scientific, Shanghai, China) to record the optical densities and testosterone concentrations derived from standard curve.
Assays for SOD and GPx activities After removing the medium, Leydig cells were suspended in 10 mM PBS (pH 7.0-7.2, 100-200 μL/106 cells) and cells lysed via homogenization. The mixture was centrifuged at 4,000 rpm for 10 min at 4 °C and supernatants (20-100 μg protein per sample according to the reagent specification) used for measurement of activity of SOD and GPx using the Total Superoxide Dismutase Assay kit (Jiancheng Bioengineering Institute, Nanjing, China) with WST-8 and Cellular Glutathione Peroxidase Assay Kit respectively (Jiancheng Bioengineering Institute, Nanjing, China). The activity of SOD and GPx was adjusted according to the protein concentrations in different samples.
Quantitative real time PCR Total RNA was isolated from the Leydig cell lysates using the miRNeasy mini kit following the manufacturer’s protocol (Qiagen, Shanghai, China). The integrity and concentration of total RNA were measured by agarose gel electrophoresis and Nanodrop-1000 spectrophotometer (Gene Company Limited, Hongkong, China), respectively. Total RNA (500 ng/sample) was then converted to cDNA using the iScript cDNA synthesis kit following the manufacturer’s instructions (Thermo Scientific, Shanghai, China). cDNA was diluted using nuclease free water to a final volume of 40 μL.
Quantitative real time PCR (qRT-PCR) was performed using a 20 μL reaction volume containing 10 μL of SYBR® premix Ex Taq™ II(Ruian Biotech., Shanghai, China), 0.4 of ROX Reference Dye II, 0.8 μL each of forward and reverse primer, 2 μL of cDNA and 6 μL of nuclease free water. Reactions were run on a 7500 Real Time PCR system (Thermo Scientific, Beijing, China) for 45 cycles of 95 °C for 15s followed by 60 °C for 1 min. GAPDH gene was used as the endogenous control. Primers were designed using Primer 3 (http://primer3.ut.ee/). The primers were as follows: GAPDH, 5′- TGGGTGTGAACCACGAGA -3′ (forward) and 5′-GGCATGGACTGTGGTCATGA -3 (reverse); Bax, 5′- AGGATGCGTCCACCAAGAAGC -3′ (forward) and 5′-CGGAAGAAGACCTCTCGGGG-3′ (reverse); Bcl-2, 5′- GGAGCGTCAACAGGGAGATG-3′ (forward) and 5′- CAGCCAGGAGAAATCAAACAGA -3′ (reverse). The relative mRNA expression level of Bax and Bcl-2 was calculated using the comparative 2−ΔΔCT method [20]. Here, we chose 20 μg/mL AM as the treatment, because the results of preliminary test indicated that AM in concentration of 20 μg/mL can significantly improve the biological function of Leydig cells, and the concentration is more economical in a real application.
Statistical analysis All data were analyzed in one way ANOVA using SPSS computer software (IBM, USA). Effects of AM treatment (control versus 20 μg/mL AM) on Bcl-2 and Bax mRNA were analyzed by Student’s t-test. Means were separated using Tukey’s test. Data are presented as mean ± SE.
