Skip to main content

Table I List of primer pairs used in real-time PCR

From: Methanolic neem (Azadirachta indica) stem bark extract induces cell cycle arrest, apoptosis and inhibits the migration of cervical cancer cells in vitro

Target genes Forward primer (5’-3’) Reverse primer (5’-3’)
GAPDH CTCCTCCACCTTTGACGCTG TCCTCTTGTGCTCTTGCTGG
Cyclin A GCAAACAGTAAACAGCCTGCGTTC TGGGTCCAGGTAAACTAATGGCTG
Cyclin B GGAGAGGTTGATGTCGAGCAAC GAGAAGGAGGAAAGTGCACCATG
CDK1 AGTCTTCAGGATGTGCTTATGCAG AGAATCCATGTACTGACCAGGAGG
Bcl2 GTGGCCTTCTTTGAGTTCGGTG GTGCCGGTTCAGGTACTCAGTC
Survivin GGACCACCGCATCTCTACATTC ATGGGGTCGTCATCTGGCTC
Snail TTACCTTCCAGCAGCCCTACGA GAGCCTTTCCCACTGTCCTCAT
MMP2 ATAACCTGGATGCCGTCGT AGGCACCCTTGAAGAAGTAGC
FAK ATCCCACACATCTTGCTGACTT GCATTCCTTTTCTGTCCTTGTC
E-cadherin GAAGGAGGCGGAGAAGAGGAC CGTCGTTACGAGTCACTTCAGG
N-cadherin AGGTGGAGGAGAAGAAGACCAGG GATGGCATCAGGCTCCACAGT