Skip to main content

Table 1 Primer pairs used for real-time PCR analysis of target genes

From: Effect of Shenkang on renal fibrosis and activation of renal interstitial fibroblasts through the JAK2/STAT3 pathway

Gene name Forward primer (5′-3′) Reverse primer (5′-3′)
β-actin (rat) CAGCTGAGAGGGAAATCGTG CGTTGCCAATAGTGATGACC
α-SMA (rat) CTACATGCGTCTGGACTTGG CCAGGGAAGAAGAGGAAGCA
JAK2 (rat) ATGTCAACCAACGTCCCTCT GAGCTTTGCTCTGGTTCTGG
STAT3 (rat) GCTGGAACGGCATCTTCAGG CTGTCTGGTCACAGACTGGT
β-actin (mouse) TATAAAACCCGGCGGCGCA TCATCCATGGCGAACTGGTG
α-SMA (mouse) GTCCCTCTATGCCTCTGGAC AAGGAATAGCCACGCTCAGT
FSP-1 (mouse) AGCTGCATTCCAGAAGGTGA ATGCAGGACAGGAAGACACA
Col I (mouse) TGGAAACCCGAGGTATGCTT CATTGCATTGCACGTCATCG
Col III (mouse) ACTGGTGAACGTGGCTCTAA AACCTGGAGGACCTGGATTG
FN (mouse) TCACCTACGGAGAGACAGGA TGTTGTTGATGGTGGCTGTG
STAT3 (mouse) TGGTGTCTCCACTTGTCTACCTCTAC GTGTCACACAGATGAACTTGGTCTT
JAK2 (mouse) GGAATGGCCTGCCTTACAATG TGGCTCTATCTGCTTCACAGAAT
TGF-β (mouse) TTGCTTCAGCTCCACAGAGA CAGAAGTTGGCATGGTAGCC
SOCS1 (mouse) CCCTCTTAACCCGGTACTCC CTCCCACGTGGTTCCAGAAA
SOCS3 (mouse) GCAGGAGAGCGGATTCTACT TGGATGCGTAGGTTCTTGGT