Skip to main content

Table 1 Primers sequences used for RT-PCR analyses

From: In the presence of TGF-β1, Asperosaponin VI promotes human mesenchymal stem cell differentiation into nucleus pulposus like- cells

Name   5→sequence→3 Product size NCBI Reference Sequences(Ref Seq)
GAPDH Sense CCAGAACATCATCCCTGCCT 185 NM_00125679
Antisense CCTGCTTCACCACCTTCTTG
COL2A1 Sense TCCACGGAAGGCTCCCAGAA 141 NM_001844.5
Antisense CCTGCTATTGCCCTCTGCCC
Aggrecan Sense CCTCTGGACAACCAGGTATTAG 97 NM_001135
Antisense CCAGATGTTTCTCCACTCAGAT
SOX9 Sense GAGCTGAGCAGCGACGTCAT 130 NM_000346.4
Antisense CGTAGCTGCCCGTGTAGGTG
KRT19 Sense GGAAGACACACTGGCAGAAA 112 NM_002276.5
Antisense CTCACTATCAGCTCGCACATC
PAX1 Sense CCGCTCGCTATGGAGCAGAC 204 NM_001257096.1
Antisense GGAGCCGGTCTCGTTGTAGC