Skip to main content

Table 1 Primers used for gene induction studies

From: Ginger relieves intestinal hypersensitivity of diarrhea predominant irritable bowel syndrome by inhibiting proinflammatory reaction

Gene name Accession number Primer pairs (forward and reverse) Product size (bp)
TNF-α NM_013693 F: 5′-CTGAACTTCGGGGTGATCGG
R: 5′-GGCTTGTCACTCGAATTTTGAGA
122
IL-6 NM_001314054 F: 5′- CTGCAAGAGACTTCCATCCAG
R: 5′- AGTGGTATAGACAGGTCTGTTGG
131
iNOS NM_010927 F: 5′- CAGATCGAGCCCTGGAAGAC
R: 5′- CTGGTCCATGCAGACAACCT
249
GAPDH NM_001289726 F: 5′- AGGTCGGTGTGAACGGATTTG
R: 5′- GGGGTCGTTGATGGCAACA
95