Skip to main content

Table 2 Primers for real-time PCR analyses

From: Antioxidant activity of selenium-enriched Chrysomyia megacephala (Fabricius) larvae powder and its impact on intestinal microflora in D-galactose induced aging mice

Gene Accession No. Primer Sequences (5`-3`) Product Size/bp
Nrf2 NM_010902.3 CTGGCTGATACTACCGCTGTTC 208 bp
AGGTGGGATTTGAGTCTAAGGAG
SOD1 NM_011434.1 ATGTGACTGCTGGAAAGGACG 200 bp
CGCAATCCCAATCACTCCAC
GSH-Px NM_008160.6 CCAGGAGAATGGCAAGAATGA 137 bp
GGAAGGTAAAGAGCGGGTGA
GAPDH NM_008084.2 CCTCGTCCCGTAGACAAAATG 133 bp
TGAGGTCAATGAAGGGGTCGT