Skip to main content

Table 1 Primers Sequences for qRT-PCR and MSP used in this study

From: Indirubin inhibits Wnt/β-catenin signal pathway via promoter demethylation of WIF-1

Inolucrin F-TCAATACCCATCAGGAGCAAATG
R-GAGCTCGACAGGCACCTTCT
TGase1 F-TCTTCAAGAACCCCCTTCCC
R-TCTGTAACCCAGAGCCCTTCGA
Keratin17 F-GAGATTGCCACCTACCGC
R-TGCCATCCTGGACCTGTT
Loricrin F-TCATGATGCTACCCGAGGTTTG
R-CAGAACTAGATGCAGCCGGAGA
Filaggrin F-CTCAGCACAAGGAAGACAGG
R- TTGTGTTCTGGTGGCTTGTC
GAPDH F-CGGAGTCAACGGATTTGGTCGTAT
R-AGCCTTCTCCATGGTGGTGAAGAC
pRL-TK-WIF-1 F-CGGAGTCAACGGATTTGGTCGTAT
R-AGCCTTCTCCATGGTGGTGAAGAC
Methylated primer F- 5-CGTTTTATTGGGCGTATCGT-3
R- 5-ACTAACGCGAACGAAATACGA-3
Unmethylated primer F- 5-GGGTGTTTTATTGGGTGTATTGT-3
R-5-AAAAAAACTAACACAAACAAAATACAAAC-3