Skip to main content

Table 1 Primer sequences for RT-PCR

From: Negative chronotropic and inotropic effects of lubiprostone on iPS cell-derived cardiomyocytes via activation of CFTR

GeneAccessionSense primer sequence (5'-3')Antisense primer sequence (5'-3')Annealing temperature[°C]
Rex1NM_009556ACGAGTGGCAGTTTCTTCTTGGGATATGACTCACTTCCAGGGGGCACT65
NanogAB903574GCTTACAAGGGTCTGCTACTCCTCAGGACTTGAGAGCTTT60
GFPNC_011521AGAAGAACGGCATCAAGGTGCTCGTTGGGGTCTTTGCTCA65
GATA4NC_000080GCAGCAGCAGTGAAGAGATGGCGATGTCTGAGTGACAGGA60
cTn INC_000073CTCCTCTGCCAACTACCGAGCTCAAACTTTTTCTTGCGGC60
cTn TNC_000067ATCCCCGATGGATTCCCACGAGTTTTGGAGAC65
Cx43NC_000076TTGACTTCAGCCTCCAAGGAATGAACAGCACCGACAGC65
CFTRNM_021050AGTTTCCTGGACAGCTCACTAATGGCCTGCTGGAAGAT60
CLC2NM_009900CTTAGAGTGGGAAGAACACTCCTTTAGGGTGACAATCC60
βactinNM_007614TTCCTTCTTGGGTATGGAATGAGCAATGATCTTGATCTTC60