Skip to main content

Table 2 Primers used for real-time RT-PCR

From: The effectiveness of traditional Japanese medicine Goshajinkigan in irradiation-induced aspermatogenesis in mice

geneForward Primer(5′-3′)Reverse Primer(5′-3′)
caspase8TTGAACAATGAGATCCCCAAACCATTTCTACAAAAATTTCAAGCAG
claudin-3TCTCCCAGCCTACGGAGTTACAGTTCCCATCTCTCGCTTC
claudin-11TCACAACGTCCACCAATGACTGGGCACATACAGGAAACCAGATG
FasGCAGACATGCTGTGGATCTGGTCACAGCCAGGAGAATCGCAG
FasLTCCAGGGTGGGTCTACTTACTACCCCTCTTACTTCTCCGTTAGGA
GAPDHTGTGTCCGTCGTGGATCTGATTGCTGTTGAAGTCGCAGGAG
Ki67GCTGTCCTCAAGACAATCATCAGGCGTTATCCCAGGAGACT
occludinCTTCTGCTTCATCGCTTCCCTTGCCCTTTCCTGCTTTC
ZO-1ACAAACAGCCCTACCAACCCCATCCTCATCTTCATCTTCTTC
ZO-2GTTTTTCTTCGTCCTAGTCCCCATCCATCCCTTCCATCTTTC
\