Skip to main content

Table 1 The specification of the primers for amplification of the targeted genes

From: Experimental validation and computational modeling of anti-influenza effects of quercetin-3-O-α-L-rhamnopyranoside from indigenous south African medicinal plant Rapanea melanophloeos

Gene name Primer sequence (5′ to 3′) Accession number Position Size (bp) Tm (°C) Optimized annealing temperature (Ta) (°C)
IL-6-F GTTCGGATAATGTAGCCT NM_001003301.1 633–650 135 40.6 53.9
IL-6-R TCACAGAGAACAACATAACT   751–768   40.5  
CCL-2-F GTGATCTTCAAGACCGTCCTAA NM_001003297.1 191–212 130 47.9 59.5
CCL-2-R TTCAGAGTGAGTATTCATGGCTT   299–321   46.6  
IFN-β-F AAACTTCACCTGGGACAA NM_001135787.1 390–407 118 40.6 55.9
IFN-β-R TTTCTGCTTGGACTATTGT     39.5