Skip to main content

Table 1 Real-time fluorescent quantitative PCR primers

From: Qingkailing injection ameliorates cerebral ischemia-reperfusion injury and modulates the AMPK/NLRP3 Inflammasome Signalling pathway

Gene namesForwardReverse
NLRP3CAGCGATCAACAGGCGAGACAGAGATATCCCAGCAAACCTATCCA
ASCGCTGAGCAGCTGCAAACGAACTTCTGTGACCCTGGCAATGA
Caspase-1ACTCGTACACGTCTTGCCCTCACTGGGCAGGCAGCAAATTC
IL-1βCCCTGAACTCAACTGTGAAATAGCACCCAAGTCAAGGGCTTGGAA
GAPDHGAACATCATCCCTGCATCCACCAGTGAGCTTCCCGTTCA