Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 List of primers

From: Jiang-Zhi granules decrease sensitivity to low-dose CCl4 induced liver injury in NAFLD rats through reducing endoplasmic reticulum stress

Gene Forward primer Reverse primer
GRP78 GACTGGAATCCCTCCTGCTC GGTCAGGCGGTTTTGGTC
PERK TGGTAAAGTCATCCCCATCAGTC CCTTGTAGGGAACTTTTCCGAG
EIF2α CTGGGACCCCTAACCTACAAC CATCTGACCAGGAAGGACACC
NF-kB CTGCTTACGGTGGGATTGC TGTTTCTTTCTCAGGGGGATTC
IRE1α GAGGAATTACTGGCTTCTCATAGG TTCTCGATGTTTGGGAAGATTG
TRAF2 TCCACCTATGATGGGGTCTTC GCCGTCGCCATTCAAGTAG
β-actin CCCATCTATGAGGGTTACGC TTTAATGTCACGCACGATTTC