Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers of quantitation Real-time PCR (qRT-PCR) used in this study

From: Antimicrobial characteristics of Berberine against prosthetic joint infection-related Staphylococcus aureus of different multi-locus sequence types

Gene Name Primer Sequences (5′–3′)
icaA F TGCTGGCGCAGTCAATACTA
  R CATGGCAAGCGGTTCATACT
icaR F CCTTATTTTCAGAGAAGGGGTATG
  R CGAATACACTTCATCTTTGAATTG
fnbA F GTCAAGTTATGGCGACAGGA
  R GCGTCACTGTTGTAGGATCA
lrgA F GTCGTGAAACAACAAAAAGACGCA
  R TTAATCATGAGCTTGTGCCTCCTC
lrgB F GCATCGTATCATCGGAGGTA
  R GGTAACGCAATCGCTGTAGT
cidA F ATATTGGCACAGAAATTCAAAAGA
  R TCATAAGCGTCTACACCTTTACGA
srrB F CGCTTGCCATTGTCCTTGAT
  R CTTGGTCCATGCGATCCATA
spa F AAGAAGACGGCAACAAGCCT
  R AGGCTTGTTGCCGTCTTCTT
nuc F ATGGACGTGGCTTAGCGTAT
  R TAGCCAAGCCTTGACGAACT
pyk a F AATGGTTGCACGTGGTGACA
  R TAGATTGCGTTGGCAACGTC
  1. *: pyk was used as the internal reference gene.