Skip to main content

Table 1 PCR primers used for molecular identification of Candida species tested in this study

From: In vitro evaluation of the activity of an essential oil from Pistacia vera L. variety Bronte hull against Candida sp.

Molecular method Species identified Primer name Sequence (5′ → 3′) Amplicon size Reference
Singleplex PCR C. albicans CR-f GCTACCACTTCAGAATCATCATC ~ 960 bp Romeo and Criseo, 2008
Multiplex PCR C. glabrata UNI-5,8S ACCAGAGGGCGCAATGTG ~ 397 bp Romeo et al., 2009
Multiplex PCR C. parapsilosis mCPF TTTGCTTTGGTAGGCCTTCTA ~ 171 bp Asadzadeh et al., 2015