Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 2 Primers and expected sizes of polymerase chain reaction (PCR) products with each primer pair

From: Effects of ChondroT on potassium Oxonate-induced Hyperuricemic mice: downregulation of xanthine oxidase and urate transporter 1

Gene Primer sequence (5′ → 3′) Product size (bp) GenBank accession number
mURAT1 Forward: GCTACCAGAATCGGCACGCT
Reverse: CACCGGGAAGTCCACAATCC
342 NM_009203
GAPDH Forward: AGATCCACAACGGATACATT
Reverse: TCCCTCAAGATTGTCAGCAA
309 NM_008084