Skip to main content

Table 1 Both forward and reverse primer sequences for BAX, BCL2, FAS, GAPDH and 18S rRNA genes are reported

From: Meripilus giganteus ethanolic extract exhibits pro-apoptotic and anti-proliferative effects in leukemic cell lines

Gene 5′-Forward-3′ 5′-Reverse-3′
BAX AACTGGACAGTAACATGGAG TTGCTGGCAAAGTAGAAAAG
BCL2 GATTGTGGCCTTCTTTGAG GTTCCACAAAGGCATCC
FAS CTGTCCTCCAGGTGAAAG TGTACTCCTTCCCTTCTTG
GAPDH ACAGTTGCCATGTAGACC TTGAGCACAGGGTACTTTA
18S rRNA CAGAAGGATGTAAAGGATGG TATTTCTTCTTGGACACACC