Skip to main content

Table 1 The primers specification for amplification of the targeted genes

From: Immunomodulatory properties of quercetin-3-O-α-L-rhamnopyranoside from Rapanea melanophloeos against influenza a virus

Gene name Primer sequence (5′ to 3′) Accession number Position Size (bp)
PR-NP-F TCAGTGATTATGAGGGACGGrUTGAT/3Sp CY148246.1 179–198 97
PR-NP-R TTCTTCCAGGTATTTATTTCTCCTrUTCGTT/3Sp 253–276
PR-M2-F GCAGTTAAACTGTATAGGAAGCTrCAAGA/3Sp CY148244.1 311–333 69
PR-M2-R CACCAGCAGAATAACTGAGTGrAGATTC/3Sp   360–380  
TNF-α-F ATCAATCTGCCTAACTATCT NM_001003244.4 634–653 168
TNF-α-R CTGAGCCCTTAATTCTCT 785–802
IL-27-F GCTGTTCTCAGAGGTTCGG XM_844736.3 258–276 75
IL-27-R CAGGAGGTCCAGGCTTACT 315–333
GusB-F TGCTCCTCTACACCACACCTAC NM_001003191.1 532–553 80
GusB-R CCACCAGCCCAGTGTCTTG 594–612
ACTB-F CAGGAGTACGACGAGTCCG NM_001195845.1 1209–1227 87
ACTB-R CAAGAAAGGGTGTAACGCAACT 1275–1296