Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 Primer sequences for qRT-PCR gene expression study

From: In vitro characterization and in vivo toxicity, antioxidant and immunomodulatory effect of fermented foods; Xeniji™

Gene Primer sequence (5′–3′)
Forward Reverse
GCLM AATCAGCCCCGATTTAGTCAGG CCAGCTGTGCAACTCCAAGGAC
GSTA2 CGCCACCAAATATGACCTCT CCTGTTGCCCACAAGGTAGT
IL-2 TGAGTCAGCAACTGTGGTGG GCCCTTGGGGCTTACAAAAAG
IL-18 GGGCACCCTAGCTCATGTTT GCACAAGACGTGTGAGGAGA
β-actin TCCTTCCTGGGCATGGAG AGGAGGAGCAATGATCTTGATCTT