Skip to main content

Table 1 PCR conditions and primer sequence for examined genes

From: Effects of Karela (Bitter Melon; Momordica charantia) on genes of lipids and carbohydrates metabolism in experimental hypercholesterolemia: biochemical, molecular and histopathological study

mRNA expression Forward primer (5′-3′) Reverse primer (5′-3′) PCR cycles and Annealing
PEPCK (236 bp) TTTACTGGGAAGGCATCGAT TCGTAGACAAGGGGGCAC 30 cycles, 52 °C 1 min
PK (229 bp) ATTGCTGTGACTGGATCTGC CCCGCATGATGTTGGTATAG 30 cycles, 52 °C 1 min
ACO (633 bp) GCCCTCAGCTATGGTATTAC AGGAACTGCTCTCACAATGC 35 cycles, 52 °C 1 min
CPT-1 (628 bp) TATGTGAGGATGCTGCTTCC CTCGGAGAGCTAAGCTTGTC 35 cycles, 52 °C 1 min
PPAR γ (550 bp) CATTTCTGCTCCACACTATGAA CGGGAAGGACTTTATGTATGAG 33 cycles 52 °C 1 min
PPAR-α (680 bp) GAGGTCCGATTCTTCCACTG ATCCCTGCTCTCCTGTATGG 35 cycles, 58 °C 1 min
FAS (345 bp) CCAGAGCCCAGACAGAGAAG GACGCCAGTGTTCGTTCC 37 cycles, 61 °C 45 s
SREBP-1c (191 bp) GGAGCCATGGATTGCACATT AGGAAGGCTTCCAGAGAGGA 35 cycles, 58 °C 50 s
HMG-CoAR (467 bp) CCTGCTGCCATAAACTGGAT GCCATTACAGTGCCACACAC 31 cyc les58°C 1 min
GST (575 bp) GCTGGAGTGGAGTTTGAAGAA GTCCTGACCACGTCAACATAG 35 cycles, 55 °C 1 min
CYP7A1 (574 bp) CCTCCTGGCCTTCCTAAATC GTACCGGCAGGTCATTCAGT 30 cycles 58 °C 1 min
SOD (410 bp) AGGATTAACTGAAGGCGAGCAT TCTACAGTTAGCAGGCCAGCAG 33 cycles, 55 °C 1 min
GAPDH (309 bp) AGATCCACAACGGATACATT TCCCTCAAGATTGTCAGCAA 25 cycles, 52 °C 1 min