Skip to main content

Table 2 Primers used in RT-PCR

From: Triptolide Induces hepatotoxicity via inhibition of CYP450s in Rat liver microsomes

Target gene Sequence of primers
CYP3A1/3A23 forward TTTCCTTTGTCCTGCATTCC
reverse CATAGGTGGGAGGTGCCTTA
CYP3A2 forward CGTCGATTCCCTTAACAACC
reverse AATCCTTTGGGAACATGCAG
CYP3A9 forward ACAAAGACCCGCATTACTGG
reverse GCAAACCTCATGCCAATACA
CYP3A18 forward CCAATAAGGCACCTGTCACC
reverse AGGGTTCCGATGAAGAGGAT
CYP3A62 forward GATGTGGAGATTGTGGCTCA
reverse TCTGGAGATCAGGGTGTGTG
CYP2C9 forward CTGCTGCTGCTGAAACACGTG
reverse GGATGACAGCGTACTATCAC
β-actin forward TCACCCACACTGTGCCCATCTATGA
reverse CATCGGAACCGCTCATTGCCGATAG