Skip to main content

Table 1 Real-time RT-PCR oligonucleotide primers

From: The anti-inflammatory activities of ethanol extract from Dan-Lou prescription in vivo and in vitro

Gene Primer Sequence (5′–3′) PCR product (bp)
β-actin Forward TGTTACCAACTGGGACGACA 165
(NM_007393.3) Reverse GGGGTGTTGAAGGTCTCAAA  
 iNOS Forward CACCTTGGAGTTCACCCAGT 170
(NM_010927.3) Reverse ACCACTCGTACTTGGGATGC  
 COX-2 Forward TGAGTACCGCAAACGCTTCTC 151
(NM_011198.3) Reverse TGGACGAGGTTTTTCCACCAG  
 IL-6 Forward TCCAGTTGCCTTCTTGGGAC 140
(NM_031168.1) Reverse GTGTAATTAAGCCTCCGACTTG