Skip to main content

Table 1 The oligonucleotides used as primers

From: Stauntonia hexaphylla (Lardizabalaceae) leaf methanol extract inhibits osteoclastogenesis and bone resorption activity via proteasome-mediated degradation of c-Fos protein and suppression of NFATc1 expression

Gene Forward primer (5'-3') Reverse primer (5'-3')
c-Fos GGTGAAGACCGTGTCAGGAG TATTCCGTTCCCTTCGGATT
NFATc1 GAGTACACCTTCCAGCACCTT TATGATGTCGGGGAAAGAGA
TRAP ACTTCCCCAGCCCTTACTACCG TCAGCACATAGCCCACACCG
OSCAR GGAATGGTCCTCATCTCCTT TCCAGGCAGTCTCTTCAGTTT
CtsK CCAGTGGGAGCTATGGAAGA CTCCAGGTTATGGGCAGAGA
β3-integrin GGAGTGGCTGATCCAGATGT TCTGACCATCTTCCCTGTCC
ATP6v0d2 GACCCTGTGGCACTTTTTGT GTGTTTGAGCTTGGGGAGAA
GAPDH TCAAGAAGGTGGTGAAGCAG AGTGGGAGTTGCTGTTGAAGT