Skip to main content

Table 1 Primer sequences used in this study

From: Oligonol suppresses lipid accumulation and improves insulin resistance in a palmitate-induced in HepG2 hepatocytes as a cellular steatosis model

Genes Forward primer Reveres primer Tm (C°)
ACC GAAGTCAGAGCCACGGCACA GGCAATCTCAGTTCAAGCCAGTC 62
FAS AGCACTGCCTTCGGTTCAGTC AAGAGCTGTGGAGGCCACTTG 62
SREBP1c CTCCGGCCACAAGGTACACA GAGGCCCTAAGGGTTGACACAG 60
HSL CAAGTGTGTCAGCGCCTATGCT GGGCTTTCTGGTCTGAGTTGGA 64
PPARγ CTTGTGAAGGATGCAAGGGT ATACAAATGCTTTGCCAGGG 62
CPT-1a GGAATGAAATTCCCACTGTCTGTC CAGTTCAGCCATCGCTGTTGTA 60
HADHα ACTTCCAAAGACACCAGTGCTTCA GGCGCAAGACACCTGGTAGTATAGA 60
LCAD CCAGCTGCATGAAGCGAAAC GCTGAACTCTGGCATCCACATAA 60
UCP2 TGTGCCCTTACCATGCTCCA AGGGCTCGTTTCAGCTGCTC 60
CYP2E1 ATGTCTGCCCTCGGAGTGA GATGTCCTTCCAGGTAGGTCC 58
CYP4A11 AGGAGCTCCAACAGGACCAG CCTGATGGGTGAAGGCACAC 68
PPARα TCCTGAGCCATGCAGAATTTAC AGTCTAAGGCCTCGCTGGTG 60
TNFα GACAAGCCTGTAGCCCATGTTGTA CAGCCTTGGCCCTTGAAGA 60
IL-6 GTGGAGATTGTTGCCATCAACG CAGTGGATGCAGGGATGATGTTCTG 60
MCP-1 AGCAGCAAGTGTCCCAAAGA GGTGGTCCATGGAATCCTGA 60
STAT3 GGAATCCCGTGGGTTGCTTAC TTGAATGCAGTGGCCAGGAC 60
SOCS3 CAGGAATGTAGCAGCGATGGAA CCTGTCCAGCCCAATACCTGA 60
GAPDH TGAACGGGAAGCTCACTGG TCCACCACCCTGTTGCTGTA 58–64