Skip to main content


Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences used in RT-PCR analysis

From: Cytotoxicity effect of degraded and undegraded kappa and iota carrageenan in human intestine and liver cell lines

Gene Primer Sequences Expected size (bp) Annealing temp. (°C)/time (s) # of cycles
GAPDH Forward 5′ CCATGGAGAAGGCTGGG 3′ 195 55°C/30s 30
PCNA Forward 5′ TCCCACGTCTCTTTGGTGC 3′ 155 60°C/30s 30
MKI67 Forward 5′ GGAAAGTAGGTGTGAAAGAAGAGG 3′ 458 50°C/60s 30
Survivin Forward 5′ GGCATGGGTGCCCCGACGTT 3′ 439 62°C/60s 30