Skip to main content

Table 1 Primer sequences

From: HOX-7 suppresses body weight gain and adipogenesis-related gene expression in high-fat-diet-induced obese mice

Gene name Forward primers (5′-3′) Backward primers (5′-3′)
PPARγ TTCGGAATCAGCTCTGTGGA CCATTGGGTCAGCTCTTGTG
C/EBPα AAACAACGCAACGTGGAGAC ACCAAGGAGCTCTCAGGCAG
SREBP1c ATCGCAAACAAGCTGACCTG AGATCCAGGTTTGAGGTGGG
LXR TCCTACACGAGGATCAAGCG AGTCGCAATGCAAAGACCTG
LPL AGGACCCCTGAAGACACAGC TTGGGCACCCAACTCTCATA
aP2 AGCATCATAACCCTAGATGG GAAGTCACGCCTTTCATAAC