Skip to main content

Table 1 Gene name, accession number, reverse and forward primer sequences used in GeXP multiplex gene expression analysis

From: Mechanistic basis for protection of differentiated SH-SY5Y cells by oryzanol-rich fraction against hydrogen peroxide-induced neurotoxicity

Gene name Accession number Primer sequences* with universal tags
   Forward Reverse
Antioxidant genes
Catalase NM_001752 AGGTGACACTATAGAATA GAAGTGCGGAGATTCAACACT GTACGACTCACTATAGGGA ACACGGATGAACGCTAAGCT
SOD 1 NM_000454 AGGTGACACTATAGAATATCA TCAATTTCGAGCAGAAGG GTACGACTCACTATAGGGA TGCTTTTTCATGGACCACC
SOD 2 NM_000636 AGGTGACACTATAGAATA CATCAAACGTGACTTTGGTTC GTACGACTCACTATAGGGA CTCAGCATAACGATCGTGGTT
Downstream apoptotic genes
BAD NM_004322 AGGTGACACTATAGAATA CGGAGGATGAGTGACGAGTT GTACGACTCACTATAGGG AGGAGTTTCGGGATGTGGAG
TNF NM_000594 AGGTGACACTATAGAATA CTATCTGGGAGGGGTCTTCC GTACGACTCACTATAGGG AATGTTCGTCCTCCTCACAGG
ING3 NM_198267 AGGTGACACTATAGAATA AGGTTCAGTTGGCAAACCAG GTACGACTCACTATAGGG AAGCCAAAAGTGAGCATGTGTT
BAK1 BC004431 AGGTGACACTATAGAATA AGCCTGTTTGAGAGTGGCAT GTACGACTCACTATAGGG AAGTGATGCAGCATGAAGTCG
BAX BC014175 AGGTGACACTATAGAATA CCCTTTTGCTTCAGGGTTTC GTACGACTCACTATAGGG ACAAAGTAGAAAAGGGCGACAA
p21 NM_000389 AGGTGACACTATAGAATA TTAGCAGCGGAACAAGGAGT GTACGACTCACTATAGGG AAGCCGAGAGAAAACAGTCCA
CAS-9 NM_001229 AGGTGACACTATAGAATA GGGCTCACTCTGAAGACCTG GTACGACTCACTATAGGG ATCTGGAAGCTGCTAAGAGCC
BCL-2 M14745 AGGTGACACTATAGAATA ACCACTAATTGCCAAGCACC GTACGACTCACTATAGGG ATTTTCCATCCGTCTGCTCTT
Upstream apoptotic genes
ERK1/2 NM_002745 AGGTGACACTATAGAATA GGAGCAGTATTACGACCCGA GTACGACTCACTATAGGGA GATGTCTGAGCACGTCCAGT
p53 NM_001126117 AGGTGACACTATAGAATA GGGGAGCAGGGCTCA GTACGACTCACTATAGGGA AAAATGGCAGGGGAGGG
JNK NM_139046 AGGTGACACTATAGAATA CAGAAGCTCCACCACCAAAGAT GTACGACTCACTATAGGGA GCCATTGATCACTGCTGCAC
PARP1 NM_001618 AGGTGACACTATAGAATA TATCGAGTCGAGTACGCCAA GTACGACTCACTATAGGGA GTGTGGGACTTTTCCATCAAA
AKT1 NM_001014431 AGGTGACACTATAGAATA GAGGAGATGGACTTCCGGTC GTACGACTCACTATAGGGA AGGATCTTCATGGCGTAGTAGC
NF-kB NM_001077493 AGGTGACACTATAGAATA GCGGGCGTCTAAAATTCTG GTACGACTCACTATAGGG ATTCCACGATCACCAGGTAGG
p38 NM_001315 AGGTGACACTATAGAATA TTCAGTCTTTGACTCAGATGCC GTACGACTCACTATAGGGA GTCAGGCTTTTCCACTCATCT
Housekeeping genes
GAPDH a NM_002046 AGGTGACACTATAGAATA AAGGTGAAGGTCGGAGTCAA GTACGACTCACTATAGGGA GATCTCGCTCCTGGAAGATG
Hyaluronidase a AJ000099 AGGTGACACTATAGAATA CAGCAGTTCATGCTGGAGAC GTACGACTCACTATAGGGA CCAGGTAGACAGACGGGAAG
18 sRNA a M10098 AGGTGACACTATAGAATA GGAGTGGAGCCTGCGGCTTAA GTACGACTCACTATAGGGA TAGCATGCCAGAGTCTCGTT
Actb a,# NM_001101 AGGTGACACTATAGAATA GATCATTGCTCCTCCTGAGC GTACGACTCACTATAGGGA AAAGCCATGCCAATCTCATC
Kan(r) b - AGGTGACACTATAGAATA ATCATCAGCATTGCATTCGATTCCTGTTTG GTACGACTCACTATAGGGA ATTCCGACTCGTCCAACATC
  1. *Based on the Homo sapien gene sequences adopted from the National Center for Biotechnology Information GenBank Database.
  2. aHousekeeping genes; bInternal control; #Normalization gene.
\