Skip to main content

Table 1 Sequences of the upstream and downstream primers used in this study

From: Vitamin C treatment attenuates hemorrhagic shock related multi-organ injuries through the induction of heme oxygenase-1

Gene Primer sequences (5′→3′)
TNF-α upper CCCAATCTGTGTCCTTCTAACT
  lower CACTACTTCAGCGTCTCGTGT
IL-6 upper CAAAGCCAGAGTCATTCAAGC
  lower GGTCCTTAGCCACTCCTTCTGT
HO-1 upper ACCCCACCAAGTTCAAACAG
  lower GAGCAGGAAGGCGGTCTTAG
β-actin upper GCGCTCGTCGTCGACAACGG
  lower GTGTGGTGCCAAATCTTCTCC
\