Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 The primer characteristics used for the gene expression analysis

From: Palm kernel cake extract exerts hepatoprotective activity in heat-induced oxidative stress in chicken hepatocytes

 Genes   Sequences (5′ to 3′) References
TNF-like1 F tgctgttctatgaccgcc [20]
R ctttcagagcatcaacgca
IL-1β2 F atg gcgttcgttcccgacctggacgtgctg [21]
R acttagcttgtaggtggcgatgttgacctg
IFN-γ3 F gctgacggtggacctattatt [21]
R tggattctcaagtcgttcatcg
GAPDH4 F tgaaagtcggagtcaacggatt [22]
R ccacttggactttgccagaga
β-Actin F caacacagtgctgtctggtgg [20]
  R atcgtactcctgcttgctgat
  1. 1In chickens, TNF-α has not been identified. but TNF-like ligand 1A (TNF-like) produced effects similar to TNF-α.
  2. 2Interleukin-1 beta.
  3. 3Interferon gamma.
  4. 4Glyceraldehyde 3-phosphate dehydrogenase.