Skip to main content

Table 1 Primer sequences used for quantitative real-time PCR in this study

From: Danning tablets attenuates α-naphthylisothiocyanate-induced cholestasis by modulating the expression of transporters and metabolic enzymes

Gene (GenBank accession no.) Sequence (5’–3’)
Asbt XM_003751634 GGATAGATGGTGACATGGAC (fw)
GAAACAGGAATAACAAGCGC (rev)
Bsep U69487 CTGATGCTTATGGGAGGCGTAT (fw)
TCTGGTGGAAGGAGCTGTTGATC (rev)
Cyp2b1 NM_001134844 GCTATGGTTTCCTGCTGATGCTC (fw)
GACTCTGTGTGGTACTCCAATAGGG (rev)
Mdr2 NM_012690 GTTGAAATGAAAATGTTGGCTGG (fw)
ATGCCGTAGATGTGAGCCTTCC (rev)
Mrp2 NM_012833 TCAGATGAGGAGGTTTGGAGGG (fw)
CTCTGTCACTTCGGATAACAACCC(rev)
Mrp3 NM_080581 TGAAGAGACTGGAATCCGTTAGCC (fw)
GTTGGAGGCGATGTAAGGATAAGTG (rev)
Mrp4 NM_133411 GACACCAAAAACGCGAACGG (fw)
ACAAGGACATAGAACACCAGCAGG (rev)
Ntcp NM_017047 CTACCTCCTCCCT GATGCCCTT (fw)
TGAGGATGGTAGAACAGAGTTGAATG (rev)
Oatp1 NM_017111 TGCCTGCCTTCTTCATTCTGATACT (fw)
GTTTTCAGTTCTCCGTCATTCTCG (rev)
Ostα NM_001107087 TCCTCTGTCCCTGAGCCTTATC (fw) TCTCTGCTTTCACCATTTATTACAA (rev)
Ostβ XM_238546 TGCTTTGGTATTTCCGTTC (fw)
TCTGGCATTCCGTTGTCTT (rev)
Sult2a1 NM_131903 ATCAAAAAGAAAGGACCACGACTC (fw)
AACCATTCAACATAAGTTCCCAGTG (rev)
Ugt1a1 NM_012683 TGAAGCCTATGTCAACGCCTC (fw)
CGATGGTCTAGTTCCGGTGTAGC (rev)
Gapdh NM_017008 AGAAGGTGGTGAAGCAGGCATC (fw)
CGAAGGTGGAAGAGTGGGAGTTG (rev)
  1. fw: forward primer; rev: reverse primer; bp: base pair.