Skip to main content

Table 1 Primer sequence and condition for RT-PCR

From: Compound danshen tablet ameliorated aβ25-35-induced spatial memory impairment in mice via rescuing imbalance between cytokines and neurotrophins

Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′) Condition PCR product length (bp)
β-actin TGGAATCCTGTGGCATCCA TAACAGTCCGCCTAGAAGCA 95°C 3 min, (94°C 45 s, 55°C 45 s, 72°C 45 s) for 32 cycles, 72°C 10 min 343
IL-6 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA 95°C 5 min, (94°C 30 s, 58°C 30 s, 72°C 60 s) for 35 cycles, 72°C 10 min 141
TNF-α GGCAGGTCTACTTTGGAGTCATTGC ACATTCGAGGCTCCAGTGAATTCGG 95°C 5 min, (94°C 30 s, 58°C 30 s, 72°C 60 s) for 35 cycles, 72°C 10 min 300
RACK1 ACCAACAAGGCGATTTGTCG GCAGACACCCAGAGTATTCCATA 94°C 2 min, (94°C 30 s, 52°C 30 s, 72°C 2 min) for 32 cycles, 72°C 8 min 136
BDNF AGCCTCCTCTGCTCTTTCTGCTGGA CTTTTGTGTATGCCCCTGCAGCCTT 95°C 5 min, (95°C 45 s, 58°C 45 s, 72°C 60 s) for 32 cycles, 72°C 10 min 298