Skip to main content

Table 1 PCR sequences and PCR products

From: Effects of astragalus injection on the TGFβ/Smad pathway in the kidney in type 2 diabetic mice

Name Length Upstream primer (5′-3′) Downstream primer (5′-3′)
TGF-β1 493 bp TCCCTCAACCTCAAATTATTCA GCGGTCCACCATTAGCAC
TGFβ-RI 172 bp GGCGAAGGCATTACAGTGTT TGCACATACAAATGGCCTGT
Smad7 309 bp ACAGAAAGTGCGGAGCAAGAT CTGATGAACTGGCGGGTGTAG
Smad3 232 bp GGGCCAACAAGTCAACAAGT CTGGCTGGCTAAGGAGTGAC
β-actin 243 bp GAAATCGTGCGTGACATTAAGG CACGTCACACTTCATGATGGAG