Skip to main content

Table 1 The sequence, T m and amplicon size of the designed primers used in PCR

From: Effect of black tea extract on herpes simplex virus-1 infection of cultured cells

Primers Target genes Nucleotide sequence (5′ to 3′) Tm(°C) Amplicon (nt)
gD1F HSV-1 US6 AGACGTCCGGAAACAACCCTACAA 64.6 752
gD1R ACACAATTCCGCAAATGACCAGGG 64.6
GFPF HSV-1 GFP TGACCCTGAAGTTCATCTGCACCA 64.6 717
GFPR AACTCCAGCAGGACCATGTGAT 62.7
VP1F HSV-1 UL46 ACCAAGCCTTGATGCTCAACTCCA 64.6 957
VP1R ACAACACGGTTCCCGAGAGTTTGA 64.6