Apoptosis induction and inhibition of invasion and migration in gastric cancer cells by Isoorientin studied using network pharmacology

Abstract

Background

To investigate the effects of Isoorientin on the apoptosis, proliferation, invasion, and migration of human gastric cancer cells (HGC27 cells).

Methods

We used network pharmacology to predict the targets of drugs and diseases. The CCK-8 assay was used to determine the effects of Isoorientin on the proliferation of HGC27 cells. Flow cytometry was employed to analyze the effects of Isoorientin on cell apoptosis and cell cycle distribution of HGC27 cells. Scratch test and transwell chamber test were conducted to assess the effects of Isoorientin on invasion and migration, respectively. Additionally, qPCR and western blot were performed to examine the impact of Isoorientin on apoptosis-related genes and protein expression, respectively.

Results

The Isoorientin significantly inhibited the proliferation, migration, and invasion of HGC27 cells compared to the control group. Furthermore, Isoorientin induced apoptosis in HGC27 cells by upregulating the relative expression of Bax and caspase-3 while downregulating the relative expression of p-PI3K, p-AKT, and Bcl-2 proteins.

Conclusion

The Isoorientin exhibits inhibitory effects on the proliferation, invasion, and migration of HGC27 cells, and induces apoptosis in gastric cancer cells.

Introduction

Gastric cancer (GC) is a common gastrointestinal malignancy worldwide. There were about 397,000 new cases of GC in China in 2016 and approximately 289,000 deaths. According to the National Central Cancer Registry of China, GC mortality is the third highest among all malignant tumors. Early cancer has no evident symptoms, and the early detection rate is low in China, with most patients being diagnosed in the advanced stage [1, 2]. Environmental and genetic factors can affect GC development; these include ethnicity, gender, age, smoking, diets high in nitrates and nitrites, infection with Helicobacter pylori and Epstein-Barr virus, previous stomach surgery, pernicious anemia, and history of mucosa-associated lymphoid tissue lymphoma [3,4,5].

Current treatment helps control this disease, and systemic chemotherapy is the primary method. Although chemotherapy prolongs survival, the outcomes are poor, and treatment is associated with many side effects [6]. Five-year survival for stage IA and IB tumors treated with surgery ranges from 60 to 80%. However, the 5-year survival rate among patients with stage III tumors undergoing surgery ranges from 18 to 50% [7]. Despite progress in medical technology, endoscopic technology, and immunotherapy, current treatment methods have limited therapeutic effects, and GC’s mortality in China remains high [8,9,10,11]. Therefore, there is an urgent need to develop new anti-GC drugs. Traditional Chinese medicine has become an essential component in clinical tumor treatment [12, 13], and many studies have shown that traditional Chinese medicine successfully treats GC [14, 15]. It can significantly alleviate the side effects caused by chemotherapy and prolong survival [16, 17].

Tibetan medicine has a long and varied tradition. It is an essential component of the traditional Chinese medicine system, which is rich in various active ingredients and can exert anti-tumor effects via several pathways and targets. It is characterized by easy absorption and minimal toxic side effects. RenQing ChangJue was first recorded in the “Si Bu Yi Dian” and is known as the King of Tibetan Medicine. It combines 160 natural, pure, rare, and precious Tibetan medicinal herbs grown on the Qinghai Tibet Plateau, including musk, bear bile, and bezoar [18]. It is widely used to treat tumors, gastroenteritis, gastrointestinal ulcers, atrophic gastritis, toxicosis, syphilis, acute and chronic hepatitis, cholecystitis, rheumatoid arthritis, chronic fever, gastric bleeding, and iron-deficiency anemia, etc. [19]. Clematis florida is a traditional Tibetan medicine and an essential component of RenQing ChangJue. Isoorientin is a natural plant extract derived from C. florida, with a molecular weight 448.38. Isoorientin possesses many biological activities, including antioxidant, anti-inflammatory, antitumor, and antibacterial effects [20,21,22,23]. Isoorientin relieves fat accumulation, eliminates reactive oxygen species, and inhibits mitogen-activated protein kinase (MAPK) activation and nuclear factor-k-gene binding (NF-_kB) p65 nuclear translocation [24,25,26]. Although Isoorientin has extensive biological activity, its role in GC has received little attention. Therefore, this study examined the effects of Isoorientin on apoptosis, proliferation, and migration of the GC cell line HGC27.

Materials and methods

Reagents

Isoorientin (Cat# 4261–42-1) and Paclitaxel (Cat# 33069–62-4) was purchased from Chengdu Herbpurify co., LTD (Chengdu, China). HGC27 and NCI-N87 cells were purchased from Shanghai Shaijie co., LTD (Shanghai, China). The cell counting kit-8 (CCK-8) (Cat# E606335) was purchased from Sangon Biotech (Shanghai, China). Primary antibodies for phosphoinositide 3-kinase (PI3K) (Cat# AF6241), p-PI3K (Cat# AF3242), protein kinase B (AKT) (Cat# AF0836), p-AKT (Cat# AF6261), B cell lymphoma 2 (BCL-2) (Cat# AF6139), Bcl-2-associated X protein (BAX) (Cat# AF0120), caspase-3 (Cat# AF6311) and β-actin (Cat# AF7018) were purchased from Affinity (Jiangsu, China). cleaved-caspase-3 (Cat# ab32042) were purchased from abcam (Shanghai, China). Cell culture medium was purchased from GibcoTM Invitrogen (Thermo Fisher, New York). Mitochondrial membrane potential assay kit with JC-1 (Cat# M8650) was purchased from Solarbil (Beijing, China).

Network pharmacology analysis

Target intersection analysis of C. florida and GC was performed as follows. 1) the components of C. florida were searched in CNKI, Wanfang Database, and PubMed. The target proteins of bioactive components in C. florida were retrieved from the traditional Chinese medicine systems pharmacology (TCMSP) database (http://tcmspw.com/), PubChem, and the Swiss Target Prediction database. 2) We searched for disease-related targets in the DisGeNET database using the keyword “gastric carcinoma.” 3) The C. florida bioactive component and GC disease targets were imported into the Wayne analysis software after removing duplicates.

Protein–protein interaction (PPI): The targets obtained through the method above were subjected to PPI analysis using the STRING database (https://string-db.org/). The PPI network was analyzed using Cytoscape (http://www.cytoscape.org/, version 3.9.0), and the core targets were filtered based on the degree value.

Pathway enrichment analysis: Gene ontology (GO) analysis and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of critical targets was built using MetaScape software. The top 20 biological processes, molecular function, cellular component, and KEGG pathways with P < 0.05 were identified. Finally, visualization processing was carried out on the Bioinformatics platform.

Cell culture and treatment

Gastric cancer cells were cultured at 37 °C under 5% CO₂ in Dulbecco’s modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS) (Hyclone, South America) with 100 IU/mL streptomycin and 100 IU/mL penicillin (Amresco, USA) in a Thermo incubator. Cells were divided into the following groups: (1) Control; (2) 200 nM Paclitaxel as a positive control; (3) 35 µM Isoorientin; (4) 70 µM Isoorientin; and (3) 140 µM Isoorientin.

Cell viability

Cell viability was measured using the CCK8 assay. Isoorientin was dissolved in dimethylsulfoxide and prepared as a 100 mM storage solution. Gastric cancer cells were seeded in 96-well culture plates overnight. Various concentrations of Isoorientin were added to the wells. After treatment, 10 µL CCK8 reagent was added to each well, followed by incubation at 37 °C for 1 h, and the absorbance was measured at 450 nm. The results were expressed as the relative percentage of the control group.

Colony formation assay

For the colony-formation assay, 500 HGC27 cells were seeded in 6-well plates with the medium changed every three days for 3 weeks. The cells were fixed with 4% paraformaldehyde for 15 min, the fixative was aspirated, and the cells were washed once in phosphate-buffered saline. Then dye with crystal violet for 5 min. Colony counting is performed and analyzed using Prism software.

Cell cycle analysis

HGC27 cells were treated with Paclitaxel or Isoorientin for 48 h. The cell cycle was examined using a DNA content detection kit (Cat# CA1510 Solarbio, Beijing, China). Cells were collected and fixed in cold 95% ethanol for 2 h. Subsequently, cells were centrifuged at 1500 rpm for 5 min, and the supernatants were discarded. The cells were washed twice with cooled PBS, stained with 0.4 mL of propidium iodide for 30 min, and measured using flow cytometry.

Cell invasion and migration analyses

The cell invasion assay used Millicell inserts (Costar, USA) coated with Matrigel (Cat# 356237, Corning, USA). HGC27 cells were treated with Paclitaxel or Isoorientin, and 2 × 10⁴ cells were seeded in the upper chambers in FBS-free DMEM, while the lower chambers were loaded with DMEM containing 10% FBS. The non-migrating cells on the upper cavity were removed 48 h later with a cotton swab, and the cells invading the lower side of the membrane through the Matrigel layer were fixed, stained, and counted.

For the cell migration assay, cells were treated with Paclitaxel or Isoorientin and cultured as confluent monolayers. A defect in the monolayer was created using a 1000-μl pipette tip. Cells were cultured for 48 h, and migration was recorded under an inverted microscope.

Cell apoposis analysis

Apoptosis was measured using an Annexin V- FITC/PI Kit apoptosis detection kit (Cat# FXP018, 4A Biotech, China) and flow cytometry. After treatment, cells were harvested, washed in cold PBS, and labeled with Annexin V- FITC for 30 min at 4 °C in the dark, followed by incubation with propidium iodide. Flow cytometry analysis was performed on a flow cytometer and analyzed using FlowJo software (BD Biosciences, USA).

Mitochondrial membrane potential assay

After treatment, cells were washed once with PBS, added 1 mL of JC-1 staining reagent working solution and the same volume of RPMI 1640 culture medium mixture, culture at 37 °C for 20 min. After incubation, aspirate the supernatant, wash twice with JC-1 staining buffer, add 2 ml of cell culture solution, and observe the fluorescence intensity of mitochondrial membrane potential under laser confocal scanning microscope.

RNA Extraction and qPCR analysis

Total RNA was isolated from HGC27 cells using the TRIzol reagent (Cat# 10296028, Invitrogen, USA) according to the manufacturer’s instructions, and 1 μg total RNA was reverse-transcribed using ReverTrace (Cat# 11752050, ABI-invitrogen, USA). SYBR green-based real-time quantitative PCR using a High Fidelity PrimeScriptTM RT-PCR Kit (Cat# 4472920, ABI-invitrogen, USA) was performed using a CFX96 connect instrument (Bio-Rad, USA). β-actin rRNA served as a control. The primers are as following:

Target Name	Primer
actin	F	TCCTCCTGAGCGCAAGTACTCC
	R	CATACTCCTGCTTGCTGATCCAC
PI3K	F	TTATAAACGAGAACGTGTG
	R	AATAGCTAGATAAGCC
AKT	F	CAGCATCGCTTCTTTGCCGGTA
	R	CCTGGTGTCAGTCTCCGACGTGA
mTOR	F	GTGGTGGCAGATGTGCTTAG
	R	TTCAGAGCCACAAACAAGGC
Bcl-2	F	GAGGAGCTTTGTTTCAACCA
	R	AATACCATGAATTAAATGCGGAA
BAX	F	GTCCACCAAGAAGCTGAGCGAGT
	R	TCCACGGCGGCAATCATCC
Caspase3	F	ATGACATCTCGGTCTGGTA
	R	CTTTAGAAACATCACGCATC
Caspase6	F	CCAACATAACTGAGGTGGATGC
	R	TTCACAGTTTCCCGGTGAG

Western blots analysis

Protein concentrations for cell lysates were determined using a BCA protein assay kit (Cat# MD913053, MDL). Proteins were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membranes, and blocked with 5% skim milk for 1 h at room temperature. Proteins were then detected using primary antibodies incubated overnight at 4 °C, followed by secondary antibodies for 1 h at room temperature. The primary antibody were diluted as following: β-actin 1:1000, PI3K 1:500, p-PI3K 1:1000, AKT 1:1000, p-AKT 1:1000, BCL-2 1:1000, BAX 1:1000, Caspase3 1:1000, and cleaved-caspase-3 1:1000.

Statistical analysis

The data were expressed as mean ± standard deviation. Significant differences were expressed as ^* P < 0.05, ^** P < 0.01, and ^*** P < 0.001.

Results

Network pharmacology analysis of the target pathway of C. florida for GC treatment

We used the TCMSP database to search for the bioactive components of C. florida and found that eight active ingredients had Oral bioavailability (OB) ≥ 20% and Drug-likeness (DL) index ≥ 0.09. These included luteolin, apigenin, quercetin, kaempferol, Isoorientin, hederagenin3-O-arabinoside, a-hederin, and lignan (Table 1), and 337 component targets (Fig. 1A). Comparing the active ingredients with GC targets using Wayne analysis yielded 188 anti-GC targets (Fig. 1A). Using the STRING database, 188 intersection targets of C. florida and GC were subjected to PPI (Fig. 1B). Cytoscape 3.9.0 was used for calculation, and the targets with degree values ≥ 40 were identified. AKT1, TNF, VEGFA, EGFR, SRC, Caspase3, STAT3, MAPK3, and ESR1 were the genes with the top ten degree values (Fig. 1C).

Table 1 Characteristics of bioactive components in Clematis florida

Fig. 1

A Wayne analysis of potential targets of C. florida bioactive components in GC. B PPI network of 188 target genes. C Critical targets of C. florida bioactive components in the treatment of GC. D The GO enrichment analysis of critical targets. E The KEGG pathway enrichment analysis of critical targets

GO annotation analysis revealed that the top ten significantly enriched biological processes, cell components, and molecular functions (Fig. 1D). Possible biological processes were related to protein phosphorylation, positive regulation of phosphorylation, regulation of defense response, positive regulation of cell death, and cellular responses to organic cyclic compounds. These genes are involved in cell components, including protein kinase activity, oxidoreductase activity, transcription factor binding, protein tyrosine kinase activity, phosphatase binding, and nuclear receptor activity. KEGG pathway analysis revealed 163 related pathways to determine the possible mechanisms; 19 directly related to tumors were selected, and a bubble diagram was drawn according to the P-value. The PI3K-AKT pathway, the apoptosis pathway, the TNF pathway, the PD-1 checkpoint, the MAPK pathway, and the mTOR pathway were associated with the anti-GC effect of C. florida (Fig. 1E). The C. florida composition-pathway-target-GC network diagram was constructed using Cytoscope 3.9.0 software. According to the degree value, Isoorientin was the primary active component, PI3KR1 and AKT1 were the primary targets, and the PI3K-AKT pathway was the primary pathway.

Isoorientin reduces the viability of gastric cancer cells

As Isoorientin was the primary active component of C. florida, we then measured the anti-GC function of Isoorientin. The formula of Isoorientin is C₂₁H₂₀O₁₁ and the molecular structure diagram of Isoorientin was showed in Fig. 2A. Cell viability analysis was measured using CCK8 assay to determine the inhibitory activity of Isoorientin. As shown in Fig. 2B, Isoorientin had almost no effect on normal gastric mucosal epithelial GES-1 cells, however, the cell viability of both HGC27 and NCI-N87 cells were inhibited (Fig. 2C and D). Due to that the effect of Isoorientin on HGC27 cell is more siginificant, so we use HGC27 cell as the representative of gastric cancer cells in the follow-up study. Increasing concentrations of Isoorientin inhibited HGC27 cell growth dose-dependently (Fig. 2E and F). These findings suggest that Isoorientin inhibits HGC27 cell viability with a 50% inhibitor concentration of 69.7 µM at 48 h.

Fig. 2

The chemical structure of Isoorientin (A). GES-1 cell viability (B), HGC27 cell viability (C) and NCI-N87 cell viability (D) were detected by CCK8 assay. HGC27 cells were treated with various concentrations of Isoorientin for 48 h (E) or 72 h (F), respectively. CCK8 determined cell viability. ^** P < 0.01 and ^*** P < 0.001 vs. the control group

Isoorientin suppressed HGC27 cell proliferation

Based on the 50% inhibitory concentration (Fig. 2), three concentrations of Isoorientin were selected: low (35 µM), medium (70 µM), and high (140 µM), with Paclitaxel as the positive control. Paclitaxel significantly inhibited proliferation, and Isoorientin suppressed the HGC27 cell proliferation in a dose-dependent manner (Fig. 3A). We performed a colony-formation assay and cell cycle detection to determine the effect of Isoorientin on proliferation. The colony-formation assay indicated that Isoorientin significantly suppressed HGC27 cell proliferation (Fig. 3B). Flow cytometry revealed that Isoorientin generated fewer cells in G₀/G₁ phase and more cells in the G₂/M phase (from 19.33% to 42.47%), suggesting that Isoorientin arrests HGC27 cells in the G₂/M phase (Fig. 3C). Based on these results, it was hypothesized that Isoorientin may suppress HGC27 cell proliferation.

Fig. 3

A CCK8 was used to evaluate HGC27 cell viability after 48 h treatment with Paclitaxel and various concentrations of Isoorientin. B A colony-formation assay evaluated cell proliferation after 48 h of Paclitaxel or Isoorientin treatment. C Flow cytometry measured cell cycle distribution after Paclitaxel or Isoorientin treatment for 48 h. ^* P < 0.05 and ^*** P < 0.001 vs. the control group

Isoorientin reduced HGC27 GC cell invasion-migration ability

To determine the effect of Isoorientin on gastric carcinogenesis, we examined the effects of Isoorientin on cell invasion and migration. The Transwell assay revealed that the invasive ability of HGC27 cells was significantly less in the Isoorientin groups than in the control group (Fig. 4A). The wound-healing assay revealed that the cell migration area was significantly smaller in the Isoorientin groups than in the control (Fig. 4B). These results suggest that Isoorientin inhibits GC development.

Fig. 4

A The invasive ability was measured using a Transwell assay. B The migratory ability was measured using a wound-healing assay. ^*** P < 0.001 vs. the control group

Isoorientin reduced PI3K/AKT and induced BAX expression, leading to apoptosis activation

Flow cytometry was used to determine whether the inhibitory effect of Isoorientin on GC cell proliferation was related to apoptosis (Fig. 5A). Apoptosis in HGC27 GC cells was more significant in the Isoorientin group than in control, and there was a dose-dependent effect. Besides, to further confirm the pro apoptotic function of Isoorientin, we conducted mitochondrial membrane potential experiments. When the mitochondrial membrane potential is high, JC-1 aggregates in the mitochondrial matrix, forming a polymer that can produce red fluorescence; when the mitochondrial membrane potential is low, JC-1 cannot aggregate in the mitochondrial matrix. At this time, JC-1 is a monomer and can produce green fluorescence. As the result shown in Fig. 5B, after Isoorientin treatment, JC-1 showed an increase in monomers, indicating cell apoptosis and exhibiting dose-dependent behavior.

Fig. 5

A Apoptosis was examined by flow cytometry. B Apoptosis was determined by mitochondrial membrane potential assay, scale bar: 50 μm. C qPCR was used to detect mRNA expression of PI3K, AKT, mTOR, BCL-2, BAX, caspase-3, and caspase-6. D, E The protein expression levels of p-PI3K, PI3K, p-AKT, AKT, BAX, BCL-2, caspase-3, and cleaved-caspase-3 were examined using a western blot. The full-length blots are presented in Supplementary Figure. ^** P < 0.01 and ^*** P < 0.001 vs. the control group

BCL-2 and BAX participate in programmed cell death. The real-time PCR results showed that the anti-apoptotic gene BCL-2 was downregulated by Isoorientin in a dose-dependent manner, while the expression of the pro-apoptotic gene BAX was upregulated in the Isoorientin group compared with the control group (Fig. 5C). The western blot experiment confirmed the BCL-2/BAX result, while the protein expression of caspase-3 was more significant in the Isoorientin groups than in control (Fig. 5D), suggesting again that Isoorientin induces apoptosis in HGC27 cells.

We then elucidated the mechanism of Isoorientin-induced cell apoptosis. Because the PI3K-AKT pathway was the primary pathway for Isoorientin in GC treatment according to the network pharmacology analysis, we analyzed the PI3K-Akt pathway. Western blot analysis showed that compared with the control group, Isoorientin significantly reduced the activation of PI3K, AKT, and mammalian target of rapamycin (mTOR), demonstrated by the downregulation of phosphorylated PI3K protein and phosphorylated AKT protein (Fig. 5C-E). These findings suggest that Isoorientin promotes apoptosis in GC cells.

Discussion

GC affects many individuals yearly; it is a heterogeneous disease and an unsolved clinical problem. The improvement of sanitary conditions and the eradication of H. pylori has substantially reduced the incidence of GC. Nevertheless, much work is yet to be done to improve the dismal survival statistics for advanced and metastatic cancers. Previous studies showed that Chinese herbal medicine could replace certain substances for inhibiting tumor growth and inducing tumor cell apoptosis because of its low toxicity; high concentrations of Chinese herbal medicine extracts were shown to possess excellent biological activity [27,28,29].

Tibetan medicine is a unique medical system formed through long-term practice, and RenQingChangJue is a valuable prescription for treating digestive system diseases. Isoorientin is a flavonoid derived from RenQingChangJue; it showed potent anti-oxidation, anti-diabetic, anti-obesity, and anti-inflammatory properties and treated several metabolic complications [30,31,32,33,34]. Isoorientin not only has broad-spectrum pharmacological activities such as antioxidant and anti-inflammatory properties, but also exhibits good anti-tumor effects and low toxicity. As a natural product, Isoorientin has a wide range of sources and can be obtained through extraction of plant materials or artificial synthesis, which provides a good foundation for its development as an anti-cancer drug. Studies have shown that Isoorientin can inhibit the proliferation of a variety of tumor cells, such as human hepatoblastoma, melanoma, pancreatic cancer cells, human colorectal cancer cells and gastric cancer cells, showing strong pertinence [35,36,37]. We used Isoorientin to treat HGC27 GC cells and analyzed the killing effect of Isoorientin. The CCK-8 assay showed that the Isoorientin significantly inhibited cell proliferation with a dose-dependent effect (Figs. 2 and 3A) while exhibiting significant inhibitory effects on clone formation, invasion, and migration (Figs. 3B and 4A, B).

When a cell becomes cancerous, the host loses control of the cell cycle. Therefore, blocking the cell cycle can be used for tumor treatment, blocking the circulation of cancer cells, thereby preventing their metastasis and spread and inducing tumor cell apoptosis [38]. Apoptosis is crucial in cell proliferation, differentiation, aging, and death. We used flow cytometry to detect the cell cycle and apoptosis after Isoorientin treatment. Isoorientin inhibited the cell cycle by arresting the G2/M cycle (Fig. 3C) and promoting apoptosis in GC cells (Fig. 5A). It has been shown that BCL-2 and BAX control programmed cell death [39,40,41]. Therefore, we measured the levels of BCL-2 and BAX after treatment with Isoorientin and found that Isoorientin inhibited the expression of BCL-2 and increased the expression of BAX; this effect may be mediated by blocking the PI3K-AKT pathway (Fig. 5B, C). In summary, Isoorientin regulates the expression of BCL-2/BAX through the PI3K-AKT pathway, triggering apoptosis and cell cycle arrest and inhibiting cell invasion and migration in HGC27 cells. Zhang et al. [42] reported that through ROS mediated MAPK/STAT3/NF-κB and AKT signaling pathways, Isoorientin triggererd apoptosis and cell cycle arrest in AGS cells. On the other hand, Isoorientin reduced cell migration through ROS mediated GSK-3β signaling pathway. In our research, we mainly through network pharmacology methods, relying on database retrieval, data mining, computer simulation and other technical means, information is obtained through database websites, such as active ingredient collection and screening, prediction of active ingredient targets, integration of disease targets and compound targets, etc., to reveal the complex relationship between drugs and diseases, and we have combined certain confirmatory experiments to provide technological support for the development of Isoorientin and the rational use of Isoorientin in clinical practice. These findings suggest that Isoorientin may be a promising drug for GC treatment.

As an anti-cancer drug, the advantages of Isoorientin lie in its multiple pharmacological activities, natural sources, and strong targeting. Its mechanism of action involves inhibiting tumor cell proliferation, promoting tumor cell apoptosis and autophagy, and influencing tumor development through signaling pathways. These studies provide strong scientific basis for the application of Isoorientin in the field of anti-cancer.