Skip to main content

Table 1 Primers and Probe Sequences for Real-time PCR

From: Arctiin suppresses H9N2 avian influenza virus-mediated inflammation via activation of Nrf2/HO-1 signaling

Gene Primers and Probes Sequence (5′ → 3′)
IL-6 Forward CGGGAACGAAAGAGAAGCTCTA
Reverse CGCTTGTGGAGAAGGAGTTCA
Probe TCCCCTCCAGGAGCCCAGCT
TNF-α Forward AACATCCAACCTTCCCAAACG
Reverse GACCCTAAGCCCCCAATTCTC
Probe CCCCCTCCTTCAGACACCCTCAACC
COX-2 Forward GAATCATTCACCAGGCAAATTG
Reverse TTTCTGTACTGCGGGTGGAAC
Probe TTCCTACCACCAGCAACCCTGCCA
GAPDH Forward GAAGGTGAAGGTCGGAGTC
Reverse GAAGATGGTGATGGGATTTC
Probe CAAGCTTCCCGTTCTCAGCC