Skip to main content

Table 1 Real-time PCR primer sequence

From: Effects of Stephania hainanensis alkaloids on MSU-induced acute gouty arthritis in mice

Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
NLRP3 GGGACTCAAGCTCCTCTGTG GAGGCTCTGGTTATGGGTCA
Caspase-1 TCCGCGGTTGAATCCTTTTCAGA ACCACAATTGCTGTGTGTGCGCA
IL-1훽 CCTCGTGCTGTCGGACCCATA CAGGCTTGTGCTCTGCTTGTGA
TNF-훼 CAAAGGGAGAGTGGTCAGGT GGCAACAAGGTAGAGAGGC
GAPDH TGTCATACTTGGCAGGTTTCT CGTGTTCCTACCCCCAATGT