Skip to main content

Table 8 List of qRT-PCR primers for DEGs

From: The enzymatic hydrolysates from deer sinew promote MC3T3-E1 cell proliferation and extracellular matrix synthesis by regulating multiple functional genes

Gene name Primer Sequence
Gstp1 Forward primer ATGCCACCATACACCATTGTC
Reverse primer GGGAGCTGCCCATACAGAC
Timp1 Forward primer GCAACTCGGACCTGGTCATAA
Reverse primer CGGCCCGTGATGAGAAACT
Serpine1 Forward primer TTCAGCCCTTGCTTGCCTC
Reverse primer ACACTTTTACTCCGAAGTCGGT
Cyr61 Forward primer CTGCGCTAAACAACTCAACGA
Reverse primer GCAGATCCCTTTCAGAGCGG
Crlf1 Forward primer CTCCCTGCAAGCTACCTGC
Reverse primer AGGGTGGAGGTGTTAAGGAGG
Thbs1 Forward primer GGGGAGATAACGGTGTGTTTG
Reverse primer CGGGGATCAGGTTGGCATT
Mt1 Forward primer GAGTCTGTAGTTGTCGCAGTTG
Reverse primer GGCCTTTTTGGAAGGAAGAGGA
Cdc20 Forward primer TTCGTGTTCGAGAGCGATTTG
Reverse primer ACCTTGGAACTAGATTTGCCAG
Gas1 Forward primer CCATCTGCGAATCGGTCAAAG
Reverse primer GCTCGTCGTCATATTCTTCGTC
Nrp2 Forward primer GCTGGCTACATCACTTCCCC
Reverse primer CAATCCACTCACAGTTCTGGTG
Cmtm3 Forward primer GCCGAGTCGGGTCTTTCATTC
Reverse primer GAGGAAGTAAACGGCCAACAG
Dlk2 Forward primer GGCCAGTGTGTGTATGACGG
Reverse primer CGGCATGTGAAGTTGAGGG
Gapdh Forward primer GCACAGTCAAGGCCGAGAAT
Reverse primer GCCTTCTCCATGGTGGTGAA
\