Skip to main content

Table 1 Primers sequences used in the RT-qPCR

From: Panax notoginseng saponins promote endothelial progenitor cell angiogenesis via the Wnt/β-catenin pathway

Gene Forward primer Reverse Primer
WNT3a 5′- TGCCAGAATCGGTCACGCG-3’ 5′-CACGTTGTTGGTGCGCTGC − 3’
WNT5a 5′-TTAAGGCCAGGAGTTGCTTTG − 3’ 5′-CTGACATCTGAACAGGGTTATTCAT − 3’
LRP5 5′-CCTCCGCGCTAGACTTTGAT-3’ 5′-AAGCTCGGCTGATGGTCTTC-3’
β-catenin 5′- GGAATGGCTACCCAAGCTGA − 3’ 5′- AAGACTGTTGCTGCCAGTGA − 3’
TCF4 5′- GCCATCTTCAGTTTATGCTCC-3’ 5′-TGATGGCCATCCTGCATGAAG − 3’
VEGF-A 5′- TCCACCATGCCAAGTGGT − 3’ 5′- CCATGAACTTCACCACTTCG − 3’
bFGF 5′- AGAGAGCGTTGTGTCCATC − 3’ 5′- GCCCAGTTCGTTTCAGTGC − 3’
VE-cadherin 5′- ACACAGCCAACATCACCGTCAAG-3’ 5′- CCGCCATCTCCTCGCAGTAGG-3’
GAPDH 5′- ATTCCACGGCACAGTCAAGG-3’ 5′-ACATACTCAGCACCAGCATC-3’
\