Skip to main content

Table 1 Primer Sequences

From: Baicalein inhibits inflammatory response and promotes osteogenic activity in periodontal ligament cells challenged with lipopolysaccharides

Gene Forward (5′-3′) Reverse (5′-3′)
RUNX2 CCCGTGGCCTTCAAGGT CGTTACCCGCCATGACAGTA
OSX ACCTACCCATCTGACTTTGCTC CCACTATTTCCCACTGCCTTG
COL-I CCAGAAGAACTGGTACATCAGCAA CGCCATACTCGAACTGGAATC
IL-1β CGTTACCCGCCATGACAGTA TGCTGTAGTGGTGGTCGGAGA
TNF-α CCTGGTATGAGCCCATCTATC GGTTGGATGTTCGTCCTCCTC
MMP-1 TCGTGGTTCCAACTCGGTTT GCGGCCCTCGAAGATGA
MMP-2 CCGTCGCCCATCATCAA AGATATTGCACTGCCAACTCT
MCP-1 AGCATGACAAGGCCTGCGTC TGGCACCCAGCACAATGAA
β-actin TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGAAGCA