Skip to main content

Table 1 Primer sequences for the real-time PCR experiment

From: A randomized placebo-controlled phase I clinical trial to evaluate the immunomodulatory activities of Atractylodes lancea (Thunb) DC. in healthy Thai subjects

Gene name Forward primer Reverse primer
IL-6 GTACATCCTCGACGGCATC AGCCACTGGTTCTGTGCCT
TNF-α TGCTTGTTCCTCAGCCTCTT ATGGGCTACAGGCTTGTCACT
GAPDH TCAACGGATTTGGTCGTATT CTGTGGTCATGAGTCCTTCC
\