Skip to main content

Table 1 Primer design for rtPCR

From: Hugan Qingzhi medication ameliorates free fatty acid-induced L02 hepatocyte endoplasmic reticulum stress by regulating the activation of PKC-δ

Gene Forward Reverse
GRP78 GTCCTATGTCGCCTTCACTCC GCACAGACGGGTCATTCCAC
PERK GGCTTGAAAGCAGTTAG GGACAGTTGCCTTACAGA
ATF6 GCCGCCGTCCCAGATATTA GCAAAGAGAGCAGAATCCCA
XBP-1 GAGTTAAGACAGCGCTTGGG ACTGGGTCCAAGTTGTCCAG
CASPASE-12 ACAGCACATTCCTGGTGTTTATG CAGACTCTGGCAGTTACGGTTG
CHOP GGAAACAGAGTGGTCATTCCC CTGCTTGAGCCGTTCATTCTC
PKC-δ GAAGCAGGGATTAAAGTGTG TTCTTCTCGAAACCCTGATA
β-ACTIN TGACGTGGACATCCGCAAAG CTGGAAGGTGGACAGCGAGG