Skip to main content

Table 1 The sequences of primers used for quantitative real-time PCR

From: Anti-inflammatory activity of 3-cinnamoyltribuloside and its metabolomic analysis in LPS-activated RAW 264.7 cells

Gene Sense (5′-3′) Anti-sense (5′-3′)
IL-1β TGGAAAAGCGGTTTGTCTTC TACCAGTTGGGGAACTCTGC
IL-6 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA
iNOS CAGGAGGAGAGAGATCCGATTTA GCATTAGCATGGAAGCAAAGA
TNF-α CATCTTCTCAAAATTCGAGTGAC TGGGAGTAGACAAGGTACAACCC
GAPDH GGCCTTCCGTGTTCCTAC TGTCATCATATCTGGCAGGTT