Skip to main content

Table 1 Primer sequence for genes

From: Isatis root polysaccharide promotes maturation and secretory function of monocyte-derived dendritic cells

Name GenBank accession no. Forward primer(5′-3′) Reverse primer(5′-3′) Amplicon length
IL-1β NM214055 GAAAGATAACACGCCCACC GGAGTTTCCCAGGAAGACG 193
IL-6 M80258 CTTCAGTCCAGTCGCCTTCT GCCAGTACCTCCTTGCTGTTT 234
IL-10 L20001 GACCAGATGGGCGACTTGTT CACGGCCTTGCTCTTGTTTT 243
IL-12p35 NM213993 ATGACAACCCTGTGCCTTAG TTCAGAGCCTGCATCAGC 158
IFN-γ AY188090 TTCAAAGGAGCATGGATGTG CTCTTCCGCTTTCTTAGGTTAG 196
TNF-α JF831365 CCCCCAGAAGGAAGAGTTTC GGCATTGGCATACCCACTCT 160
PRL-19 AF435591 AACTCCCGTCAGCAGATCC AGTACCCTTCCGCTTACCG 147