Skip to main content

Table 1 Primer sequences for qRT-PCR

From: Qingchang Huashi granule ameliorates experimental colitis via restoring the dendritic cell-mediated Th17/Treg balance

Primer 5′-3’
IL-12-F GCTCGCAGCAAAGCAAGGTAA
IL-12-R CCATGAGTGGAGACACCAGCA
IL-10-F AGGATGCACATCAAAAGGCTT
IL-10-R GGCCTCGGTTAGGAAGGATAC
IL-17-F AGCACACCCGTCTTCTCTC
IL-17-R GCTGGAGTTCGCACTGTCC
Foxp3-F CCCATCCCCAGGAGTCTTG
Foxp3-R ACCATGACTAGGGGCACTGTA
β-actin-F CATCCGTAAAGACCTCTATGCCAAC
β-actin-R ATGGAGCCACCGATCCACA