Skip to main content

Table 2 Summary of Gene-Specific Real-Time PCR Primer Sequences

From: Anti-inflammation effects of the total saponin fraction from Dioscorea nipponica Makino on rats with gouty arthritis by influencing MAPK signalling pathway

Description Gene bank Sense primer (5′-3′) Anti-sense primer (3′-5′)
PPARγ NM_013124 TAGGTGTGATCTTAACTGTCG GCATGGTGTAGATGATCTCA
AdipoR2 NM_001037979 ATGTTTGCCACCCCTCAGTA CAGATGTCACATTTGCCAGG
GAPDH NM_008084 TGCACCACCAACTGCTTAC GATGCAGGGATGATGTTC