Skip to main content

Table 1 Primer sequences used for real-time PCR analysis

From: Regulation effects of total flavonoids in Morus alba L. on hepatic cholesterol disorders in orotic acid induced NAFLD rats

Gene Forward Reverse
h-SREBP2 AAGTCTGGCGTTCTGAGGAA AGGTCCACCTCATTGTCCAC
h-HMGCR CTTGTGTGTCCTTGGTATTAGAGCTT GCTGAGCTGCCAAATTGGA
h-SR-BI CTTAAGAACGTGCGCATCGA TGCTTTTGTGCCTGAACTCC
h-LXRɑ GGAGGTACAACCCTGGGAGT AGCAATGAGCAAGGCAAACT
h-LXRβ CCCCTTCTTCTTCACCCACT CGACTGTGACTGTGACTCCT
h-β-actin CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAATGCA
r-SREBP2 AGAAGGAGAAAGGCGGACAA TCTCCTGGCGCAGTTTATGA
r-HMGCR AGAGCTGGCTTGAAACACCTGA TTTGGACTGGAGACGGATGTAGA
r-CYP7A1 TTGGAATAAGGAGAAGGAAAGC GGAGTTTGTGATGAAATGGACA
r-miR-33a CCTCATAAGCGGTGCATTGTA TATGCTTGTTCTCGTCTCTGTGTC
r-GAPDH GGTGAAGGTCGGTGTGAACG CTCGCTCCTGGAAGATGGTG
  1. SREBP2 sterol regulatory element binding protein 2; HMGCR HMG-CoA reductase; CYP7A1 cytochrome P450 family 7 subfamily A member 1; LXRα liver X receptor ɑ; LXRβ liver X receptor β; SR-BI scavenger receptor class B type 1; GAPDH glyceraldehyde-3-phosphate dehydrogenase; miR-33a microRNA-33a