Skip to main content

Table 1 Primers used for qRT-PCR

From: The toxicity assessment of extract of Peganum harmala L. seeds in Caenorhabditis elegans

Gene Forward primer Reverse primer
GAPDH CGTCAAGCTCGTCTCTTGGT AGAGGTCACTTCAAGCTCTTTTCT
tub-1 GTCATCAAAGTGCGGGAAGC ACTGCATACGTGGTTGAGCA
ctl-2 ACACTCATTTCCACCGCCTT TCCCAGAATTGACGGGGTTG
sod-3 CCACCTGTGCAAACCAGGAT CATGGACATAGTCTGGGCGG
hsp-16.1 GTCTCGCAGTTCAAGCCAGA TCGCTTCCTTCTTTGGTGCT
hsp-16.2 TACCACTATTTCCGTCCAGCTCA TGTTCTCCTTGGATTGATAGCGTA