Skip to main content

Table 2 Primers used for RT-PCR

From: Ameliorative effects of sea buckthorn oil on DNCB induced atopic dermatitis model mice via regulation the balance of Th1/Th2

Gene Primer sequence
IL-4 Forward: 5′-ACAGGAGAAGGGACGCCAT-3′
Reverse: 5′-GAAGCCCTACAGACGAGCTCA-3′
IFN-γ Forward: 5′- TGAGCTCATTGAATGCTTGG −3′
Reverse: 5′- GGCCATCAGCAACAACATAA −3′
TNF-α Forward: 5′-GGAAAGGACGGACTGGTGTA-3′
Reverse: 5′- TGCCACTGGTCTGTAATCCA −3′
GAPDH Forward: 5′-TGGTGAAGGTCGGTGTGAAC-3′
Reverse: 5′-ACTGTGCCGTTGAATTTGCC-3′