Skip to main content

Table 2 Primers for quantitative real-time PCR (qRT-PCR) used in this study

From: Mechanism of Heshouwuyin inhibiting the Cyt c/Apaf-1/Caspase-9/Caspase-3 pathway in spermatogenic cell apoptosis

Gene Primer sequences Product size (bp)
Apaf-1 F:CGGCCCTGCGCATCTGATTCAT 288
R:GGGCGAACGACTAAGCGGGACAG
Cyt c F:GCTAAACACCAGGACGGAACT 293
R:CCACTCCCAATCAGGCATGAAC
Caspase-9 F:CTGAGCCAGATGCTGTCCCATA 176
R:GACACCATCCAAGGTCTCGATGTA
Caspase-3 F:GACTGCGGTATTGAGACAGA 209
R:CGAGTGAGGATGTGCATGAA
β-actin F:CCCATCTATGAGGGTTACGC 150
R:TTTAATGTCACGCACGATTTC